Dataset for CDS BCL-2-like of organism Mesocricetus auratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1U7QU73_BCL2L1-      atgt-----------------ctcagagcaaccgggagctagtggttgac
A0A1U7QVA0_BCL2L10      atggccgaccc--gctgcgggtccgcactagactgctgctaactgactac
A0A1U7RC37_BCL2L2-      atgg-cgaccccagcctcagccccagac-acacgggctctagtggctgac
A0A1U7RC37_BCL2L2-      atgg-cgaccccagcctcagccccagac-acacgggctctagtggctgac
                        ***                    *  *  *  * *   ***   *   **

A0A1U7QU73_BCL2L1-      tttctctcctacaagctctcccagaaaggatacagctggagtcagtttag
A0A1U7QVA0_BCL2L10      ttgacgttctgtgcacg---------------------------------
A0A1U7RC37_BCL2L2-      tttgtaggctataagct---------------------------------
A0A1U7RC37_BCL2L2-      tttgtaggctataagct---------------------------------
                        **      **     *                                  

A0A1U7QU73_BCL2L1-      tgatgtcgaagagaacaggactgaggccccagaaggagccgaatcagaga
A0A1U7QVA0_BCL2L10      ----------------------------------ggagccgggtgacccc
A0A1U7RC37_BCL2L2-      ----------------------------------gaggcagaaggg----
A0A1U7RC37_BCL2L2-      ----------------------------------gaggcagaaggg----
                                                          *  ** *         

A0A1U7QU73_BCL2L1-      gggagacccccagtgccatcaatggcaacccatcctggcacctggcgga-
A0A1U7QVA0_BCL2L10      gagccaccgcccacgtc--------------------------ggcagag
A0A1U7RC37_BCL2L2-      ----------ctatgtc--------------------------tgtggag
A0A1U7RC37_BCL2L2-      ----------ctatgtc--------------------------tgtggag
                                  *   * *                           *  ** 

A0A1U7QU73_BCL2L1-      -cagccccgcggtgaatggagccactggccacagcagcagtttggatgca
A0A1U7QVA0_BCL2L10      gcggccttgctgc--g-------------ctctgtggcagagcagatcca
A0A1U7RC37_BCL2L2-      ctggccctggggaggg-------------cccagcagccgacccgctgca
A0A1U7RC37_BCL2L2-      ctggccctggggaggg-------------cccagcagccgacccgctgca
                           ***  *  *                 * * *  ** *    * * **

A0A1U7QU73_BCL2L1-      cgggaggtgatccccatggcagccgtgaagcaagcgctgagagaggccgg
A0A1U7QVA0_BCL2L10      a-----------------------------cag-----------------
A0A1U7RC37_BCL2L2-      c-----------------------------caagccatgcgggctgctgg
A0A1U7RC37_BCL2L2-      c-----------------------------caagccatgcgggctgctgg

A0A1U7QU73_BCL2L1-      cgatgagtttgaactgcggtaccggcgggcattcagtgatctgacatcc-
A0A1U7QVA0_BCL2L10      ----------cagcaccacttttttttctcctccttcgtc--ggctacca
A0A1U7RC37_BCL2L2-      agacgagtttgagacccgcttccggcgcaccttctccgacctggctgct-
A0A1U7RC37_BCL2L2-      agacgagtttgagacccgcttccggcgcaccttctccgacctggctgct-
                                   *    *  *         * * *   *    * *  *  

A0A1U7QU73_BCL2L1-      ---cagcttcatataaccccgggaactgcatatcaaagctttgagcaggt
A0A1U7QVA0_BCL2L10      gggcaaccgcgtggagctgatgacacagatggtagacgccgtgctc----
A0A1U7RC37_BCL2L2-      ---cagctccacgtgaccccaggctcagcccagcaacgcttcacccaggt
A0A1U7RC37_BCL2L2-      ---cagctccacgtgaccccaggctcagcccagcaacgcttcacccaggt
                           ** *  *      *    *   * *       * **      *    

A0A1U7QU73_BCL2L1-      agtgaatgaactcttccgggatggggtaaactggggtcgcattgtggcct
A0A1U7QVA0_BCL2L10      -cccgatgg------ccaa---gacctcaactggggccgcctggtgttgc
A0A1U7RC37_BCL2L2-      ttccgacgaacttttccaagggggccccaattggggccgtcttgtggcat
A0A1U7RC37_BCL2L2-      ttccgacgaacttttccaagggggccccaattggggccgtcttgtggcat
                             * *       **     *     ** ***** **  * ***    

A0A1U7QU73_BCL2L1-      ttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatg
A0A1U7QVA0_BCL2L10      tcttagcctttg------------------------------------cg
A0A1U7RC37_BCL2L2-      tctttgtctttggggccgccctatgtgctgaaagtgtcaacaaagaaatg
A0A1U7RC37_BCL2L2-      tctttgtctttggggccgccctatgtgctgaaagtgtcaacaaagaaatg
                        * **   *** *                                     *

A0A1U7QU73_BCL2L1-      caggtgttggtgagtcggattgca----agttggatggccacctacctga
A0A1U7QVA0_BCL2L10      gggacaattgtgagtc-aagagcagagaaaccgtctgaaggataaaatga
A0A1U7RC37_BCL2L2-      gagccacttgtgggac-aagtgcag---gattggatggtgacttacctgg
A0A1U7RC37_BCL2L2-      gagccacttgtgggac-aagtgcag---gattggatggtgacttacctgg
                          *    * *** * *  *  ***        *  **       *  ** 

A0A1U7QU73_BCL2L1-      atgaccacctagagccttggatccaggacaacggc--ggctgggac----
A0A1U7QVA0_BCL2L10      aagtgctccaagactgccaactc----atagtggccttgctgt-------
A0A1U7RC37_BCL2L2-      agacacgcctggctgactggatccacagcagtggc--ggctgggcg----
A0A1U7RC37_BCL2L2-      agacacgcctggctgactggatccacagcagtggc--ggctgggagctag
                        *    * **  *         **      *  ***   ****        

A0A1U7QU73_BCL2L1-      --actttcgtggaactctatgggaacaatgcagcagctgagagccggaaa
A0A1U7QVA0_BCL2L10      --gcaatc--------------------gactcctgaggcggc-------
A0A1U7RC37_BCL2L2-      --gagttcacagctctgtacggggacggggccctggaggaggcgcggcgt
A0A1U7RC37_BCL2L2-      aagcgatcaaagcccgagtcagggagatgga---ggaggaggctgagaag
                              **                           *  * *         

A0A1U7QU73_BCL2L1-      ggccaggagcgcttcaaccg------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
A0A1U7RC37_BCL2L2-      ctgcgggag---------------gggaactgggcctcagtgag------
A0A1U7RC37_BCL2L2-      ctaaaggagctacaaaacgaggtagagaagcagatgaatatgagtccacc

A0A1U7QU73_BCL2L1-      ----ctggttcctgac------------------------------gggc
A0A1U7QVA0_BCL2L10      ----atcgctcctggc----------------------------tggagg
A0A1U7RC37_BCL2L2-      ----gacagtgctgac-----------------------------ggggg
A0A1U7RC37_BCL2L2-      cccaggcaatgctggcccagtgatcatgtctcttgaggagaagatggagg
                                 * *** *                              * * 

A0A1U7QU73_BCL2L1-      atg---------------actgtggctggtgtggttctgctgggctctct
A0A1U7QVA0_BCL2L10      ctc---------------aaggtggctgggatggcttttgtgtcat----
A0A1U7RC37_BCL2L2-      ccg-------------------tggcactgggggccctggt---------
A0A1U7RC37_BCL2L2-      ctgatgcccgttctatctatgttggcaatgtggactatggtgcgacagca
                                              ****      *    *  *         

A0A1U7QU73_BCL2L1-      cttcagtcggaag-------------------------------------
A0A1U7QVA0_BCL2L10      ----ctttgggagtcccttaccac--------------------------
A0A1U7RC37_BCL2L2-      ----aactgtagg-------------------------------------
A0A1U7RC37_BCL2L2-      gaagagctggaagcccactttcatggctgtggttcagtcaaccgtgtcac
                                *   *                                     

A0A1U7QU73_BCL2L1-      --------------------------------------------------
A0A1U7QVA0_BCL2L10      -----------------------------------------------tcg
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      tatactctgtgacaaatttagcggccatcctaaagggtttgcatatatag

A0A1U7QU73_BCL2L1-      --------------------------------------------------
A0A1U7QVA0_BCL2L10      atttttggagcacactgctgatcaagacttttctgtcctgtgtc------
A0A1U7RC37_BCL2L2-      ----------------------------------ggcctt----------
A0A1U7RC37_BCL2L2-      agttctcagacaaagagtcggtgaggacttccctggccttagacgagtcc

A0A1U7QU73_BCL2L1-      --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      ctgtttagaggaagacaaatcaaggtgattcccaaacggaccaacagacc

A0A1U7QU73_BCL2L1-      --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      aggcatcagtacaacagaccggggtttcccgcgtgcccgataccgtgccc

A0A1U7QU73_BCL2L1-      --------------------------------------------------
A0A1U7QVA0_BCL2L10      ---------attgcaacagccatcctgtttgtctggaaaagactatta--
A0A1U7RC37_BCL2L2-      -------------------------------------------ttttgct
A0A1U7RC37_BCL2L2-      ggactaccaattacaacagctcccgatctcgattctacagcggttttaac

A0A1U7QU73_BCL2L1-      --------------------------------------------------
A0A1U7QVA0_BCL2L10      --------------------------------------------------
A0A1U7RC37_BCL2L2-      agcaag--------------------------------------------
A0A1U7RC37_BCL2L2-      agcaggccccggggtcgagtctacaggggccgggctagagcgacatcatg

A0A1U7QU73_BCL2L1-      -------------tga
A0A1U7QVA0_BCL2L10      -------------taa
A0A1U7RC37_BCL2L2-      -------------tga
A0A1U7RC37_BCL2L2-      gtattccccttactaa
                                     * *

© 1998-2019