Dataset for CDS BCL-2-like of organism Meleagris gallopavo

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G1N8C5_BCL2A1-01      --------------atggaaactgctgagttctattatgtttattattta
G1MPY7_MCL1-01        ttttcaggaatgcttcggaagctg--gaaatcaa----------------
G1MZW1_BCL2-01        --------------------------------------------------
G1N5N5_BCL2L1-01      atgtccagcagtaaccgggagtta--gtgattgactttgttt--------

G1N8C5_BCL2A1-01      gctcaagattatctgcaatatgtccttcaggaatcacgtcttggaccagc
G1MPY7_MCL1-01        --------------------------------------------------
G1MZW1_BCL2-01        --------------------------------------------------
G1N5N5_BCL2L1-01      -----------cctacaagctctcgcagaaggggcactgctggagcgagc

G1N8C5_BCL2A1-01      ccaaaccagag---------------------------------------
G1MPY7_MCL1-01        -aaaagaagaagat------------------------------------
G1MZW1_BCL2-01        --------------------------------------------------
G1N5N5_BCL2L1-01      tggaggaagaggatgagaacaggactgacactgcagcagaggcagagatg

G1N8C5_BCL2A1-01      -------------------------------------ttgctcatgtctt
G1MPY7_MCL1-01        -------------------------------------ctgcaggcggtgt
G1MZW1_BCL2-01        --------------------------------------------------
G1N5N5_BCL2L1-01      gacagcgtcctcaatgggagcccatcctggcacccgcctgccggccacgt

G1N8C5_BCL2A1-01      gcgaaatattgcatcctcactccaagatcagacaga--------------
G1MPY7_MCL1-01        --------------------------------------------------
G1MZW1_BCL2-01        --------------------------------------------------
G1N5N5_BCL2L1-01      agtgaatggagccgccgtgcacaggagcagcctggaagttcatgaaattg

G1N8C5_BCL2A1-01      --------------------------------------------------
G1MPY7_MCL1-01        --------------------------------------------------
G1MZW1_BCL2-01        --------------------------------------------------
G1N5N5_BCL2L1-01      ttcgagcatctgacgtgaggcagacgctgagagatgcaggggatgagttt

G1N8C5_BCL2A1-01      --------------ggaggcactcagacccttcttggacaggatcgatat
G1MPY7_MCL1-01        --------------------------------------------------
G1MZW1_BCL2-01        --------------------------------------------------
G1N5N5_BCL2L1-01      gagctgaggtaccggagggctttcagcgatctcacctcccagctccacat

G1N8C5_BCL2A1-01      cacctctgtagatgttgccaagagaattttcaatggagtcatggaag---
G1MPY7_MCL1-01        -------------------------------------gtgaggtggctgc
G1MZW1_BCL2-01        -------------------------------------gtggaggagc---
G1N5N5_BCL2L1-01      cacccctggcacggcgtaccagagctttgagcaggtagtgaacgaac---

G1N8C5_BCL2A1-01      --aaaaatttgctgacggaaatactaactggggacgaattatgaccatat
G1MPY7_MCL1-01        tcacgttttcagtgatggagtaacaaactggggccgagttgtcacactca
G1MZW1_BCL2-01        -----ttttccgtgatggggt---caattggggccggatcgtcgccttct
G1N5N5_BCL2L1-01      -----tcttccatgatggtgt---gaactgggggcgcatcgtggctttct
                             **   *** **       ** ***** **  *  *  *  *  

G1N8C5_BCL2A1-01      ttacttttgg--------aggtcttctcaccaagaagcttcaagagcagg
G1MPY7_MCL1-01        tctcatttggtgccttcgttgcaaaacacctgaaaagcatcaaccaagag
G1MZW1_BCL2-01        ttgagttcgg------cggcgtgatgtgcgtcgagagcgtcaaccgggag
G1N5N5_BCL2L1-01      tctccttcgg------aggggctttgtgcgtggagagcgtggacaaggag
                      *    ** **          *              *** *  *      *

G1N8C5_BCL2A1-01      gagt---tcagctcactggagaggagaaggagcagatttcttatttcatc
G1MPY7_MCL1-01        aaatgcatcagctcgctggcggggatc--------atcacagacgctttg
G1MZW1_BCL2-01        atgt------cgccgctggtggacaac--------attgccacctggatg
G1N5N5_BCL2L1-01      atgc------gggtactggtgggacgc--------attgtgtcttggatg
                                     **** *              **           * 

G1N8C5_BCL2A1-01      acagagtacatcataaataacaaagccgcatggatagatgcaaacggtgg
G1MPY7_MCL1-01        gtctcatccaagcgcgagtggctga------tgagccag------ggagg
G1MZW1_BCL2-01        accgaatacctgaacaggcacctgcacaactggatccaggacaacggagg
G1N5N5_BCL2L1-01      accacgtacttgaccgaccatctagacccctggatccaggagaatggcgg
                            * *                       **   *       ** **

G1N8C5_BCL2A1-01      ctgggaaaatggtttcctaacaaagtttgaaa------------------
G1MPY7_MCL1-01        ctggg---agggctttgtcgacttcttccg----agt-------------
G1MZW1_BCL2-01        atggg---atgccttcgtggaattgtacggcaccagt-------------
G1N5N5_BCL2L1-01      ctggg---agcgctttgtggacctgtatgggaataatgctgctgccgagc
                       ****   *    **  *       *                        

G1N8C5_BCL2A1-01      -------------gaagatcaccactatctttctctacaatt------ac
G1MPY7_MCL1-01        -------------tgaggacctgga-aagcagcatcaggaatgtgctgat
G1MZW1_BCL2-01        ------------atgaggcctttgtttgatttctcctggatctctctgaa
G1N5N5_BCL2L1-01      tgaggaagggccaggagaccttcaacaaatggctcctga----ccggggc
                                     **  *            *                 

G1N8C5_BCL2A1-01      agacatatttgcag-ctgttttttc-----------------cttg----
G1MPY7_MCL1-01        ggcctttgcaggag--tggccggcctgggggcgag-------cttg--gc
G1MZW1_BCL2-01        gaccat--cctgagcctggttctggtgggagcttgcatcactcttggcgc
G1N5N5_BCL2L1-01      gaccgtggccggag--tgcttctgctgggatc----------cctg----
                         * *      **  **                        * **    

G1N8C5_BCL2A1-01      -ttcagagactactactga
G1MPY7_MCL1-01        ctacatgatccgg------
G1MZW1_BCL2-01        ttatcttggacataag---
G1N5N5_BCL2L1-01      ----ctgagccgcaagtga

© 1998-2019