Dataset for CDS BCL-2-like of organism Mandrillus leucophaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6AD55_BCL2A1-      atgaca--------------------------------------------
A0A2K6AD55_BCL2A1-      atgaca--------------------------------------------
A0A2K5XRD4_BCL2-01      atggcg-----------cacgctgggagaacagggta--------cgata
A0A2K5XSC7_MCL1-02      at----------gtttggcctcaaaagaaacgcggtaatcggactcaacc
A0A2K5XSC7_MCL1-01      at----------gtttggcctcaaaagaaacgcggtaatcggactcaacc
A0A2K5XSC7_MCL1-03      at----------gtttggcctcaaaagaaacgcggtaatcggactcaacc
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      at---------------gtctcagagcaaccggg---------------a
A0A2K5YR37_BCL2L1-      at---------------gtctcagagcaaccggg---------------a
A0A2K6AI30_BCL2L2-      atggcgaccccagcctcggccccagacacacggg---------------c
A0A2K6AI30_BCL2L2-      atggcgaccccagcctcggccccagacacacggg---------------c

A0A2K6AD55_BCL2A1-      ----------gactgtgaatttggatatatttacag----------gcta
A0A2K6AD55_BCL2A1-      ----------gactgtgaatttggatatatttacag----------gcta
A0A2K5XRD4_BCL2-01      accgggagatagtgatgaagtaca--tccactataa----------gctg
A0A2K5XSC7_MCL1-02      tctactgtgggggggccggcttgg--gggccggcagcggcggcgccaccc
A0A2K5XSC7_MCL1-01      tctactgtgggggggccggcttgg--gggccggcagcggcggcgccaccc
A0A2K5XSC7_MCL1-03      tctactgtgggggggccggcttgg--gggccggcagcggcggcgccaccc
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      gct-------ggtggttgactttc--tctcctacaa----------gctt
A0A2K5YR37_BCL2L1-      gct-------ggtggttgactttc--tctcctacaa----------gctt
A0A2K6AI30_BCL2L2-      tct-------ggtggcagactttg--taggttataa----------gctg
A0A2K6AI30_BCL2L2-      tct-------ggtggcagactttg--taggttataa----------gctg

A0A2K6AD55_BCL2A1-      gctcag---gactatttgcagtatgttc-------tgcaga---------
A0A2K6AD55_BCL2A1-      gctcag---gactatttgcagtatgttc-------tgcaga---------
A0A2K5XRD4_BCL2-01      tcgcagaggggctacgagtggga------------tgcgggggatgtggg
A0A2K5XSC7_MCL1-02      ctccgggagggcggcttttggc-------------tacgga---gaagga
A0A2K5XSC7_MCL1-01      ctccgggagggcggcttttggc-------------tacgga---gaagga
A0A2K5XSC7_MCL1-03      ctccgggagggcggctttt-------------------------------
A0A2K5YR37_BCL2L1-      ----------------------------------atgtggaagagaacag
A0A2K5YR37_BCL2L1-      tcccagaaaggatacagctggagtcagtttagtgatgtggaagagaacag
A0A2K5YR37_BCL2L1-      tcccagaaaggatacagctggagtcagtttagtgatgtggaagagaacag
A0A2K6AI30_BCL2L2-      aggcagaagggttatgtc-----------------tgtgga---------
A0A2K6AI30_BCL2L2-      aggcagaagggttatgtc-----------------tgtgga---------

A0A2K6AD55_BCL2A1-      ------taccacaacctggatcgggtccaagcaaaacgtccagagtgcta
A0A2K6AD55_BCL2A1-      ------taccacaacctggatcgggtccaagcaaaacgtccagagtgcta
A0A2K5XRD4_BCL2-01      cgcggcgacccctggggtcgcccc---cgcaccgggcatcttctcctccc
A0A2K5XSC7_MCL1-02      ggcctcggcccggcgagagatagg---gggaggggaggccggcacggtga
A0A2K5XSC7_MCL1-01      ggcctcggcccggcgagagatagg---gggaggggaggccggcacggtga
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      gactgaggccccagaagggactgaatcggagatggagacccccagtgcca
A0A2K5YR37_BCL2L1-      gactgaggccccagaagggactgaatcggagatggagacccccagtgcca
A0A2K5YR37_BCL2L1-      gactgaggccccagaagggactgaatcggagatggagacccccagtgcca
A0A2K6AI30_BCL2L2-      -gct--ggccccggggagggccca---gcagct---gacccgctgcac--
A0A2K6AI30_BCL2L2-      -gct--ggccccggggagggccca---gcagct---gacccgctgcac--

A0A2K6AD55_BCL2A1-      caaaaggttgcattct--cagtccaaaaagaag-----------------
A0A2K6AD55_BCL2A1-      caaaaggttgcattct--cagtccaaaaagaag-----------------
A0A2K5XRD4_BCL2-01      agcccgggcaca------cgccccatcccgccgcgtcccgggacccggtc
A0A2K5XSC7_MCL1-02      ttggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcc
A0A2K5XSC7_MCL1-01      ttggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcc
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      tcaatg-----------gcaacccatcct---------------------
A0A2K5YR37_BCL2L1-      tcaatg-----------gcaacccatcctggcacctggtggacagccccg
A0A2K5YR37_BCL2L1-      tcaatg-----------gcaacccatcctggcacctggtggacagccccg
A0A2K6AI30_BCL2L2-      ------------------caagccatgcgggca-----------------
A0A2K6AI30_BCL2L2-      ------------------caagccatgcgggca-----------------

A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      gccaggacctcgccactgccgaccccggctgcccccgccgccgccgcggg
A0A2K5XSC7_MCL1-02      cggagggtcgcgcggccgccgccc--------------------------
A0A2K5XSC7_MCL1-01      cggagggtcgcgcggccgccgccc--------------------------
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      cggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
A0A2K5YR37_BCL2L1-      cggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------

A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      gcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccagg
A0A2K5XSC7_MCL1-02      -------------------------------------------------a
A0A2K5XSC7_MCL1-01      -------------------------------------------------a
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      atcccca-------------tggcagcagtaaagcaagcgctgagggagg
A0A2K5YR37_BCL2L1-      atcccca-------------tggcagcagtaaagcaagcgctgagggagg
A0A2K6AI30_BCL2L2-      -------------------------------------------------g
A0A2K6AI30_BCL2L2-      -------------------------------------------------g

A0A2K6AD55_BCL2A1-      -tggaaaagaatctgaagcc--atgcttggacaatgttaatgt-------
A0A2K6AD55_BCL2A1-      -tggaaaagaatctgaagcc--atgcttggacaatgttaatgt-------
A0A2K5XRD4_BCL2-01      ccggtgacgacttctcccgccgctaccgccgcgacttcgccga-------
A0A2K5XSC7_MCL1-02      ttggcgcggaggtc----cccgacgtcaccgcgacccccgcgaggctgtt
A0A2K5XSC7_MCL1-01      ttggcgcggaggtc----cccgacgtcaccgcgacccccgcgaggctgtt
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      caggcgacgagtttgaactgcggtaccggcgggcgttcagtga-------
A0A2K5YR37_BCL2L1-      caggcgacgagtttgaactgcggtaccggcgggcgttcagtga-------
A0A2K6AI30_BCL2L2-      ctggagatgagttcgagacccgcttccggcgcaccttctctga-------
A0A2K6AI30_BCL2L2-      ctggagatgagttcgagacccgcttccggcgcaccttctctga-------

A0A2K6AD55_BCL2A1-      ----------------tgcatccatagacactgccagaacacta----tt
A0A2K6AD55_BCL2A1-      ----------------tgcatccatagacactgccagaacacta----tt
A0A2K5XRD4_BCL2-01      --gatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctt
A0A2K5XSC7_MCL1-02      tttctttgcgcccacccgccgcgcggcgccgcttgaggagatggaagccc
A0A2K5XSC7_MCL1-01      tttctttgcgcccacccgccgcgcggcgccgcttgaggagatggaagccc
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ------------------------------gggacagcatatcagagctt
A0A2K5YR37_BCL2L1-      --cctgacatcccagctccacatcaccccagggacagcatatcagagctt
A0A2K5YR37_BCL2L1-      --cctgacatcccagctccacatcaccccagggacagcatatcagagctt
A0A2K6AI30_BCL2L2-      --tctggcggctcagctgcatgtgaccccaggctcagcacagcaacgctt
A0A2K6AI30_BCL2L2-      --tctggcggctcagctgcatgtgaccccaggctcagcacagcaacgctt

A0A2K6AD55_BCL2A1-      caatcaagtgatggaaaaggagtttgaagatggcatcattaactggggaa
A0A2K6AD55_BCL2A1-      caatcaagtgatggaaaaggagtttgaagatggcatcattaactggggaa
A0A2K5XRD4_BCL2-01      tgccacggtggtggaggagctcttcagggacggggtg---aactggggga
A0A2K5XSC7_MCL1-02      cggccgccgacgccatcatgtcgcccgaagaggagct---ggacgggtac
A0A2K5XSC7_MCL1-01      cggccgccgacgccatcatgtcgcccgaagaggagct---ggacgggtac
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      tgaacaggtagtgaatgaactcttccgggatggggta---aactggggtc
A0A2K5YR37_BCL2L1-      tgaacaggtagtgaatgaactcttccgggatggggta---aactggggtc
A0A2K5YR37_BCL2L1-      tgaaca--------------------------------------------
A0A2K6AI30_BCL2L2-      cacccaggtctccgatgaacttttccaagggggcccc---aactggggcc
A0A2K6AI30_BCL2L2-      cacccaggtctccgatgaacttttccaagggggcccc---aactggggcc

A0A2K6AD55_BCL2A1-      gaattgtaacca--------------------------------------
A0A2K6AD55_BCL2A1-      gaattgtaacca--------------------------------------
A0A2K5XRD4_BCL2-01      ggatcgtggcct--------------------------------------
A0A2K5XSC7_MCL1-02      gagccggagcctctcgggaagcggccggctgtcctgcccctgctggagtt
A0A2K5XSC7_MCL1-01      gagccggagcctctcgggaagcggccggctgtcctgcccctgctggagtt
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      gcattgtggcct--------------------------------------
A0A2K5YR37_BCL2L1-      gcattgtggcct--------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      gccttgtagcct--------------------------------------
A0A2K6AI30_BCL2L2-      gccttgtagcct--------------------------------------

A0A2K6AD55_BCL2A1-      -------------------------------------tatttgcatttga
A0A2K6AD55_BCL2A1-      -------------------------------------tatttgcatttga
A0A2K5XRD4_BCL2-01      -------------------------------------tctttgagttcgg
A0A2K5XSC7_MCL1-02      ggtcggggaatctggtaatagccccagtacggatgggtcactaccctcga
A0A2K5XSC7_MCL1-01      ggtcggggaatctggtaatagccccagtacggatgggtcactaccctcga
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -------------------------------------ttttctccttcgg
A0A2K5YR37_BCL2L1-      -------------------------------------ttttctccttcgg
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      -------------------------------------tctttgtctttgg
A0A2K6AI30_BCL2L2-      -------------------------------------tctttgtctttgg

A0A2K6AD55_BCL2A1-      aggtattctcatcaagaaa-------------------------------
A0A2K6AD55_BCL2A1-      aggtattctcatcaagaaa-------------------------------
A0A2K5XRD4_BCL2-01      tggggtcatgtgtgtggagag-----------------------------
A0A2K5XSC7_MCL1-02      cgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctg
A0A2K5XSC7_MCL1-01      cgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctg
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      cggggcactgtgcgtggaaag-----------------------------
A0A2K5YR37_BCL2L1-      cggggcactgtgcgtggaaag-----------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      ggctgcactgtgtgctgagag-----------------------------
A0A2K6AI30_BCL2L2-      ggctgcactgtgtgctgagag-----------------------------

A0A2K6AD55_BCL2A1-      -----------------------------------cttctacgacagcga
A0A2K6AD55_BCL2A1-      -----------------------------------cttctacgacagcga
A0A2K5XRD4_BCL2-01      -----------------------------------cgtcaaccgggagat
A0A2K5XSC7_MCL1-02      gagattatctctcggtaccttcgggagcaggccaccggcgccaaggacac
A0A2K5XSC7_MCL1-01      gagattatctctcggtaccttcgggagcaggccaccggcgccaaggacac
A0A2K5XSC7_MCL1-03      -----------------------------ggccaccggcgccaaggacac
A0A2K5YR37_BCL2L1-      -----------------------------------cgtagacaaggagat
A0A2K5YR37_BCL2L1-      -----------------------------------cgtagacaaggagat
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      -----------------------------------tgtcaacaaggagat
A0A2K6AI30_BCL2L2-      -----------------------------------tgtcaacaaggagat

A0A2K6AD55_BCL2A1-      attgccccgga-------tgtggatacttataaggagatttcgtattttg
A0A2K6AD55_BCL2A1-      attgccccgga-------tgtggatacttataaggagatttcgtattttg
A0A2K5XRD4_BCL2-01      gtcgcccctgg-------tggacaacatcgccctgtggatgactgagtac
A0A2K5XSC7_MCL1-02      aaagccaatgggcaggtctggggccaccagcaggaaggct----------
A0A2K5XSC7_MCL1-01      aaagccaatgggcaggtctggggccaccagcaggaaggct----------
A0A2K5XSC7_MCL1-03      aaagccaatgggcaggtctggggccaccagcaggaaggct----------
A0A2K5YR37_BCL2L1-      gcaggtattgg-------tgagtcggatcgcagcttggatggccacttac
A0A2K5YR37_BCL2L1-      gcaggtattgg-------tgagtcggatcgcagcttggatggccacttac
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      ggaaccactgg-------tgggacaagtgcaggagtggatggtggcctac
A0A2K6AI30_BCL2L2-      ggaaccactgg-------tgggacaagtgcaggagtggatggtggcctac

A0A2K6AD55_BCL2A1-      ttgctgagttcataatgaataacactggagaatggataaggcaaaacgga
A0A2K6AD55_BCL2A1-      ttgctgagttcataatgaataacactggagaatggataaggcaaaacgga
A0A2K5XRD4_BCL2-01      ctgaaccgg------cacctg-----cacacctggatccaggataacgga
A0A2K5XSC7_MCL1-02      ctggagaccttacgacgggtt-----ggggatggcgtgcagcgcaaccac
A0A2K5XSC7_MCL1-01      ctggagaccttacgacgggtt-----ggggatggcgtgcagcgcaaccac
A0A2K5XSC7_MCL1-03      ctggagaccttacgacgggtt-----ggggatggcgtgcagcgcaaccac
A0A2K5YR37_BCL2L1-      ctgaatgac------caccta-----gagccttggatccaggagaacggc
A0A2K5YR37_BCL2L1-      ctgaatgac------caccta-----gagccttggatccaggagaacggc
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      ctggagacg------cggctg-----gctgactggatccacagcagtggg
A0A2K6AI30_BCL2L2-      ctggagacg------cggctg-----gctgactggatccacagcagtggg

A0A2K6AD55_BCL2A1-      ggct-ggga-----------------------------------------
A0A2K6AD55_BCL2A1-      ggctggggg-----------------------------------------
A0A2K5XRD4_BCL2-01      ggctgggac------gcctttgtggaactgtacggcc-------------
A0A2K5XSC7_MCL1-02      gagacgg--------ccttccaa---------------------------
A0A2K5XSC7_MCL1-01      gagacgg--------ccttccaaggcatgcttcggaaactggacatcaaa
A0A2K5XSC7_MCL1-03      gagacgg--------ccttccaaggcatgcttcggaaactggacatcaaa
A0A2K5YR37_BCL2L1-      ggctgggac------acttttgtggaactctatggga-------------
A0A2K5YR37_BCL2L1-      ggctgggac------acttttgtggaactctatggga-------------
A0A2K5YR37_BCL2L1-      -----ggac------acttttgtggaactctatggga-------------
A0A2K6AI30_BCL2L2-      ggctgggcg------gagttcacagctctatacgggg-------------
A0A2K6AI30_BCL2L2-      ggctgggagctggaagctatcaaagctcgagtcagggagatggaggaaga

A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-01      aacgaag-------------------acgatgtcaaatctttgtctcgag
A0A2K5XSC7_MCL1-03      aacgaag-------------------acgatgtcaaatctttgtctcgag
A0A2K5YR37_BCL2L1-      --------------------------acaatg------------------
A0A2K5YR37_BCL2L1-      --------------------------acaatg------------------
A0A2K5YR37_BCL2L1-      --------------------------acaatg------------------
A0A2K6AI30_BCL2L2-      --------------------------acgggg------------------
A0A2K6AI30_BCL2L2-      agctgagaagctaaaggagctacagaacgaggtagagaagcagatgaata

A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-01      tgatggtccatgttttcagcgacggcgtaacaaac-------tggggcag
A0A2K5XSC7_MCL1-03      tgatggtccatgttttcagcgacggcgtaacaaac-------tggggcag
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      ---------------------------------------ccctggaggag
A0A2K6AI30_BCL2L2-      tgagtccacctccaggcaatgctggcccagtgatcatgtccattgaggag

A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      ---ccagcatgcggcctctgtttgatttctcctggct-------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-01      gattgtgactctcatttcttttggtgcctttgtggctaaacacttgaaga
A0A2K5XSC7_MCL1-03      gattgtgactctcatttcttttggtgcctttgtggctaaacacttgaaga
A0A2K5YR37_BCL2L1-      ----cagcagccg-------------------------------------
A0A2K5YR37_BCL2L1-      ----cagcagccg-------------------------------------
A0A2K5YR37_BCL2L1-      ----cagcagccg-------------------------------------
A0A2K6AI30_BCL2L2-      gcg-cggcgtctg-------------------------------------
A0A2K6AI30_BCL2L2-      aagatggaggctgatgcccgttccatctatgttggcaatgtggactatgg

A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-01      ccataaaccaagaaagctgc------------------------------
A0A2K5XSC7_MCL1-03      ccataaaccaagaaagctgc------------------------------
A0A2K5YR37_BCL2L1-      ------------agagccga------------------------------
A0A2K5YR37_BCL2L1-      ------------agagccga------------------------------
A0A2K5YR37_BCL2L1-      ------------agagccga------------------------------
A0A2K6AI30_BCL2L2-      -----cgggaggggaactgg------------------------------
A0A2K6AI30_BCL2L2-      tgcaacagcagaagagctggaagctcactttcatggctgtggatcagtca

A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-01      --------------------------------------------------
A0A2K5XSC7_MCL1-03      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      accgtgttaccatactctgtgacaaatttagtggccatcccaaaggattt

A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------gtctctgaagactctgctcagtt-
A0A2K5XSC7_MCL1-02      --------------------------------------------------
A0A2K5XSC7_MCL1-01      -----atcgaaccattagcagaaagtatcacagacgttctcgtaaggaca
A0A2K5XSC7_MCL1-03      -----atcgaaccattagcagaaagtatcacagacgttctcgtaaggaca
A0A2K5YR37_BCL2L1-      ----------------------aagggccag-gagcgcttcaaccgc---
A0A2K5YR37_BCL2L1-      ----------------------aagggccag-gagcgcttcaaccgc---
A0A2K5YR37_BCL2L1-      ----------------------aagggccag-gagcgcttcaaccgc---
A0A2K6AI30_BCL2L2-      ------------------------gcatcagtgaggac------------
A0A2K6AI30_BCL2L2-      gcgtatatagagttctcagacaaagagtcagtgaggacttccttggcctt

A0A2K6AD55_BCL2A1-      --------------------------------aaatggctttgtaaagaa
A0A2K6AD55_BCL2A1-      --------------------------------aaatggc-------acaa
A0A2K5XRD4_BCL2-01      -----------------------------------tggcc----------
A0A2K5XSC7_MCL1-02      --------------------------------ggatgggtttgtggagtt
A0A2K5XSC7_MCL1-01      aaacgggactggctagttaaacaaagaggctgggatgggtttgtggagtt
A0A2K5XSC7_MCL1-03      aaacgggactggctagttaaacaaagaggctgggatgggtttgtggagtt
A0A2K5YR37_BCL2L1-      -----------------------------------tggttc---------
A0A2K5YR37_BCL2L1-      -----------------------------------tggttc---------
A0A2K5YR37_BCL2L1-      -----------------------------------tggttc---------
A0A2K6AI30_BCL2L2-      ---------------------------------agtg-------------
A0A2K6AI30_BCL2L2-      agatgagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaa

A0A2K6AD55_BCL2A1-      gtttgaacctaaat----------ctggctgga-----------------
A0A2K6AD55_BCL2A1-      tcacatgcctatg-----------ctagtagag-----------------
A0A2K5XRD4_BCL2-01      ------------------------ctggtgggagcttgca----------
A0A2K5XSC7_MCL1-02      cttccatgtagaggacc-------tagaaggtgg----------------
A0A2K5XSC7_MCL1-01      cttccatgtagaggacc-------tagaaggtgg----------------
A0A2K5XSC7_MCL1-03      cttccatgtagaggacc-------tagaaggtgg----------------
A0A2K5YR37_BCL2L1-      ------------------------ctgacgggca----------------
A0A2K5YR37_BCL2L1-      ------------------------ctgacgggca----------------
A0A2K5YR37_BCL2L1-      ------------------------ctgacgggca----------------
A0A2K6AI30_BCL2L2-      ------------------------ctgacggggg----------------
A0A2K6AI30_BCL2L2-      ccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgc

A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K6AD55_BCL2A1-      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------tcaccc
A0A2K5XSC7_MCL1-02      ---------------------------------catcagaaatgtgctgc
A0A2K5XSC7_MCL1-01      ---------------------------------catcagaaatgtgctgc
A0A2K5XSC7_MCL1-03      ---------------------------------catcagaaatgtgctgc
A0A2K5YR37_BCL2L1-      --------------------------------------------tgactg
A0A2K5YR37_BCL2L1-      --------------------------------------------tgactg
A0A2K5YR37_BCL2L1-      --------------------------------------------tgactg
A0A2K6AI30_BCL2L2-      -----------------------------------------------ccg
A0A2K6AI30_BCL2L2-      taccgcgcccggaccaccaactacaacagttcccgctctcgattctacag

A0A2K6AD55_BCL2A1-      tgacttttctagaagttacaggaaagatctgtgaaatgctc---------
A0A2K6AD55_BCL2A1-      tcagtggcccacaggaagaagaaaatggctttgtaa--------------
A0A2K5XRD4_BCL2-01      tgg-----------------------gtgcctatctgggcc---------
A0A2K5XSC7_MCL1-02      tggcttttgcaggtgttgctggagtaggagctggtttggca---------
A0A2K5XSC7_MCL1-01      tggcttttgcaggtgttgctggagtaggagctggtttggca---------
A0A2K5XSC7_MCL1-03      tggcttttgcaggtgttgctggagtaggagctggtttggca---------
A0A2K5YR37_BCL2L1-      tggc---------------cggcgtggt-tctgctgggctc---------
A0A2K5YR37_BCL2L1-      tggc---------------cggcgtggt-tctgctgggctc---------
A0A2K5YR37_BCL2L1-      tggc---------------cggcgtggt-tctgctgggctc---------
A0A2K6AI30_BCL2L2-      tggc----actgggggccctg-----gtaactgtaggggcc---------
A0A2K6AI30_BCL2L2-      tggttttaacagcaggccccggggtcgtgtctacaggggccgggctagag
                        *                              *                  

A0A2K6AD55_BCL2A1-      --------------tctctcctgaagcaatactgttga--
A0A2K6AD55_BCL2A1-      ----------------------------------------
A0A2K5XRD4_BCL2-01      ---------------------acaagtga-----------
A0A2K5XSC7_MCL1-02      ------------tatctaataaga--tagccttactgtaa
A0A2K5XSC7_MCL1-01      ------------tatctaataaga--tag-----------
A0A2K5XSC7_MCL1-03      ------------tatctaataaga--tag-----------
A0A2K5YR37_BCL2L1-      ----------actcttcagtcggaaatga-----------
A0A2K5YR37_BCL2L1-      ----------actcttcagtcggaaatga-----------
A0A2K5YR37_BCL2L1-      ----------actcttcagtcggaaatga-----------
A0A2K6AI30_BCL2L2-      -----------ttttttgctagcaagtga-----------
A0A2K6AI30_BCL2L2-      cgacatcatggtattccccttac---taa-----------

© 1998-2019