Dataset for CDS BCL2L2 of organism Mandrillus leucophaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6AI30_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
A0A2K6AI30_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt

A0A2K6AI30_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
A0A2K6AI30_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg

A0A2K6AI30_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A2K6AI30_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga

A0A2K6AI30_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
A0A2K6AI30_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca

A0A2K6AI30_BCL2L2-      gctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccg
A0A2K6AI30_BCL2L2-      gctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccg

A0A2K6AI30_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt
A0A2K6AI30_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt

A0A2K6AI30_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
A0A2K6AI30_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc

A0A2K6AI30_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A2K6AI30_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc

A0A2K6AI30_BCL2L2-      tggctgactggatccacagcagtgggggctgggcg------gagttcaca
A0A2K6AI30_BCL2L2-      tggctgactggatccacagcagtgggggctgggagctggaagctatcaaa
                        ********************************* *      *   *** *

A0A2K6AI30_BCL2L2-      gctctatacgggg-------------------------------------
A0A2K6AI30_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
                        **** *  * ***                                     

A0A2K6AI30_BCL2L2-      --acgggg------------------------------------------
A0A2K6AI30_BCL2L2-      gaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctg
                          *** **                                          

A0A2K6AI30_BCL2L2-      ---------------ccctggaggaggcg-cggcgtctg-----------
A0A2K6AI30_BCL2L2-      gcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttcc
                                       ** * ******  *  ** * ***           

A0A2K6AI30_BCL2L2-      -------------------------------cgggaggggaactgg----
A0A2K6AI30_BCL2L2-      atctatgttggcaatgtggactatggtgcaacagcagaagagctggaagc
                                                       * * **  ** ****    

A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      tcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgaca

A0A2K6AI30_BCL2L2-      --------------------------------------------------
A0A2K6AI30_BCL2L2-      aatttagtggccatcccaaaggatttgcgtatatagagttctcagacaaa

A0A2K6AI30_BCL2L2-      gcatcagtgaggac------------------------------------
A0A2K6AI30_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
                        *  ***********                                    

A0A2K6AI30_BCL2L2-      ---------agtg-------------------------------------
A0A2K6AI30_BCL2L2-      gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa

A0A2K6AI30_BCL2L2-      ctgacggggg----------------------------------------
A0A2K6AI30_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
                        * *** ****                                        

A0A2K6AI30_BCL2L2-      -----------------------ccgtggc----actgggggccctg---
A0A2K6AI30_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
                                               * ****     ** *  ***** *   

A0A2K6AI30_BCL2L2-      --gtaactgtaggggcc--------------------ttttttgctagca
A0A2K6AI30_BCL2L2-      tcgtgtctacaggggccgggctagagcgacatcatggtattccccttac-
                          **  **  *******                    * **   **  * 

A0A2K6AI30_BCL2L2-      agtga
A0A2K6AI30_BCL2L2-      --taa
                          * *

© 1998-2019