Dataset for CDS BCL-2-like of organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6DS80_BCL2A1-      atgacagactgtgaatttggatatatttacaggctagctc------agga
A0A2K6DS80_BCL2A1-      atgacagactgtgaatttggatatatttacaggctagctc------agga
A0A2K6CIX3_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K6EA73_BCL2L2-      atggcgacccc---agcctcggccccagacacacgggctctggtggcaga
A0A2K6EA73_BCL2L2-      atggcgacccc---agcctcggccccagacacacgggctctggtggcaga
A0A2K6B2D9_BCL2L10      atggctgaccc---gttgcgggagcgcaccgagcgg-ctc--ctggccga
A0A2K6ECR0_MCL1-02      atgtttggcct----caaaagaaacgcggtaatcggactc--aacctcta
A0A2K6ECR0_MCL1-03      atgtttggcct----caaaagaaacgcggtaatcggactc--aacctcta
A0A2K6ECR0_MCL1-01      atgtttggcct----caaaagaaacgcggtaatcggactc--aacctcta
                        ***     *                        *               *

A0A2K6DS80_BCL2A1-      ctatttgcagtacgttctgc------------------------------
A0A2K6DS80_BCL2A1-      ctatttgcagtacgttctgc------------------------------
A0A2K6CIX3_BCL2-01      gtacatccactataagctgtcgcagaggggctacgagtgggatgcggggg
A0A2K6EA73_BCL2L2-      ctttgtaggttataagctgaggcagaagggttatgtctg-----------
A0A2K6EA73_BCL2L2-      ctttgtaggttataagctgaggcagaagggttatgtctg-----------
A0A2K6B2D9_BCL2L10      ctatctggg----gtgctgcgcccgggaacc-------------------
A0A2K6ECR0_MCL1-02      ctgt-gggg----gggccg-gcttgggggccggcagcgg-----------
A0A2K6ECR0_MCL1-03      ctgt-gggg----gggccg-gcttgggggccggcagcgg-----------
A0A2K6ECR0_MCL1-01      ctgt-gggg----gggccg-gcttgggggccggcagcgg-----------
                         *              * *                               

A0A2K6DS80_BCL2A1-      ----------------------agataccacaacctggatcgggtc----
A0A2K6DS80_BCL2A1-      ----------------------agataccacaacctggatcgggtc----
A0A2K6CIX3_BCL2-01      atgtgggcgcggcgacccctggggccgcc----cccgcaccgggcatctt
A0A2K6EA73_BCL2L2-      -------------------tggagctggc----cctggggagggcc----
A0A2K6EA73_BCL2L2-      -------------------tggagctggc----cctggggagggcc----
A0A2K6B2D9_BCL2L10      ----------------------cggcacc----cctgagccaagac----
A0A2K6ECR0_MCL1-02      -------------------cggcgccacc----cctccgggagggc----
A0A2K6ECR0_MCL1-03      -------------------cggcgccacc----cctccgggagggc----
A0A2K6ECR0_MCL1-01      -------------------cggcgccacc----cctccgggagggc----
                                               *    *    **        *      

A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6CIX3_BCL2-01      ctcctcccagcccgggcacacgccccatcccgccgcgtcccgggacccgg
A0A2K6EA73_BCL2L2-      -----------------------------------ca-------------
A0A2K6EA73_BCL2L2-      -----------------------------------ca-------------
A0A2K6B2D9_BCL2L10      -----------------------------------cgtccacgccc----
A0A2K6ECR0_MCL1-02      -----------------------------------ggcttttggctacgg
A0A2K6ECR0_MCL1-03      -----------------------------------ggctttt--------
A0A2K6ECR0_MCL1-01      -----------------------------------ggcttttggctacgg

A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6CIX3_BCL2-01      tcgccaggacctcgccgctgccgaccccggctgcccccgccgccgccgcg
A0A2K6EA73_BCL2L2-      --------------------------------------gcagctgacccg
A0A2K6EA73_BCL2L2-      --------------------------------------gcagctgacccg
A0A2K6B2D9_BCL2L10      --------------------------------------gaggccgccgtg
A0A2K6ECR0_MCL1-02      agaaggaggcctcggcccggcgagagatagggggaggggaggccggcacg
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      agaaggaggcctcggcccggcgagagatagggggaggggaggccggcacg

A0A2K6DS80_BCL2A1-      ----------------------caa--------------gcaaaacgtcc
A0A2K6DS80_BCL2A1-      ----------------------caa--------------gcaaaacgtcc
A0A2K6CIX3_BCL2-01      gggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgcca
A0A2K6EA73_BCL2L2-      ctg----------------caccaa--------------gccatgcgggc
A0A2K6EA73_BCL2L2-      ctg----------------caccaa--------------gccatgcgggc
A0A2K6B2D9_BCL2L10      ctg---------------------c--------------gctccgcggcc
A0A2K6ECR0_MCL1-02      gtgattggcggaagcgccggcgcaa--------------gccccccggcc
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      gtgattggcggaagcgccggcgcaa--------------gccccccggcc

A0A2K6DS80_BCL2A1-      a---------------------gagtgctacaaaag--------------
A0A2K6DS80_BCL2A1-      a---------------------gagtgctacaaaag--------------
A0A2K6CIX3_BCL2-01      ggccggtgac------------gacttctcccgccgctacc---------
A0A2K6EA73_BCL2L2-      agctggagat------------gagttcgagacccgcttcc---------
A0A2K6EA73_BCL2L2-      agctggagat------------gagttcgagacccgcttcc---------
A0A2K6B2D9_BCL2L10      gcc-------------------aggttacggcagctccacc---------
A0A2K6ECR0_MCL1-02      gccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcgc
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      gccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcgc

A0A2K6DS80_BCL2A1-      --------------------------------gttgcattctcagtccaa
A0A2K6DS80_BCL2A1-      --------------------------------gttgcattctcagtccaa
A0A2K6CIX3_BCL2-01      --------------------------------gccgcgacttcgccg-ag
A0A2K6EA73_BCL2L2-      --------------------------------ggcgcaccttctctg-at
A0A2K6EA73_BCL2L2-      --------------------------------ggcgcaccttctctg-at
A0A2K6B2D9_BCL2L10      --------------------------------ggtccttcttctccgcct
A0A2K6ECR0_MCL1-02      ggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgc
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      ggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgc

A0A2K6DS80_BCL2A1-      aaagaagtggaaaagaatctgaagccatgcttggacaatgttaatgttgc
A0A2K6DS80_BCL2A1-      aaagaagtggaaaagaatctgaagccatgcttggacaatgttaatgttgc
A0A2K6CIX3_BCL2-01      atgtccagccagctgcacctgacgcc------------------------
A0A2K6EA73_BCL2L2-      ctggcggctcagctgcatgtgacccc------------------------
A0A2K6EA73_BCL2L2-      ctggcggctcagctgcatgtgacccc------------------------
A0A2K6B2D9_BCL2L10      accgcggct------------acccc------------------------
A0A2K6ECR0_MCL1-02      ccacccgcc------------gcgcg------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      ccacccgcc------------gcgcg------------------------

A0A2K6DS80_BCL2A1-      atccatagacactgccagaacactattcaatcaagtgatggaaa------
A0A2K6DS80_BCL2A1-      atccatagacactgccagaacactattcaatcaagtgatggaaa------
A0A2K6CIX3_BCL2-01      ------cttcaccgcgcggggacgctttgccacggtggtggagg------
A0A2K6EA73_BCL2L2-      ------aggctcagcacagcaacgcttcacccaggtctccgatg------
A0A2K6EA73_BCL2L2-      ------aggctcagcacagcaacgcttcacccaggtctccgatg------
A0A2K6B2D9_BCL2L10      ------gggaaccgcgtcgagctg-gtggcgctgatggcggaggccgt--
A0A2K6ECR0_MCL1-02      ------gggccgcttgaggagatg-gaagccccggccgccgacgccatca
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      ------gggccgcttgaggagatg-gaagccccggccgccgacgccatca

A0A2K6DS80_BCL2A1-      ----------------------------------aggagtttgaagatgg
A0A2K6DS80_BCL2A1-      ----------------------------------aggagtttgaagatgg
A0A2K6CIX3_BCL2-01      -------------------------------------agctcttcaggga
A0A2K6EA73_BCL2L2-      ------------------------------------aacttttccaaggg
A0A2K6EA73_BCL2L2-      ------------------------------------aacttttccaaggg
A0A2K6B2D9_BCL2L10      --------------------------------------gctctccgacag
A0A2K6ECR0_MCL1-02      tgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaag
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      tgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaag

A0A2K6DS80_BCL2A1-      c------------atcattaactggggaag---------aattgtaacca
A0A2K6DS80_BCL2A1-      c------------atcattaactggggaag---------aattgtaacca
A0A2K6CIX3_BCL2-01      c------------ggggtgaactgggggag---------gatcgtggcct
A0A2K6EA73_BCL2L2-      -------------ggccccaactggggccg---------ccttgtagcct
A0A2K6EA73_BCL2L2-      -------------ggccccaactggggccg---------ccttgtagcct
A0A2K6B2D9_BCL2L10      c---------cccggccccacctggggcagggtggtgtcgctggtgacct
A0A2K6ECR0_MCL1-02      cggccggctgtcctgcccctgctggagttggtcggggaatctggtaatag
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      cggccggctgtcctgcccctgctggagttggtcggggaatctggtaatag

A0A2K6DS80_BCL2A1-      tatttgc----------------atttgaaggta--ttctcatcaagaaa
A0A2K6DS80_BCL2A1-      tatttgc----------------atttgaaggta--ttctcatcaagaaa
A0A2K6CIX3_BCL2-01      tctttga----------------gttcggtggggtcatgtgtgtggagag
A0A2K6EA73_BCL2L2-      tctttgt----------------ctttggggctgcactgtgtgctgagag
A0A2K6EA73_BCL2L2-      tctttgt----------------ctttggggctgcactgtgtgctgagag
A0A2K6B2D9_BCL2L10      tcgcggg--------------------gacgctg--ctg-----------
A0A2K6ECR0_MCL1-02      ccccagtacggatgggtcactaccctcgacgccg--ccgccagcagagga
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      ccccagtacggatgggtcactaccctcgacgccg--ccgccagcagagga

A0A2K6DS80_BCL2A1-      cttctacgac----------------------------------------
A0A2K6DS80_BCL2A1-      cttctacgac----------------------------------------
A0A2K6CIX3_BCL2-01      cgtcaaccgg----------------------------------------
A0A2K6EA73_BCL2L2-      tgtcaacaag----------------------------------------
A0A2K6EA73_BCL2L2-      tgtcaacaag----------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6ECR0_MCL1-02      ggaggaggacgagttgtaccggcagtcgctggagattatctctcggtacc
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      ggaggaggacgagttgtaccggcagtcgctggagattatctctcggtacc

A0A2K6DS80_BCL2A1-      ---agcgaattgccccggatgt---ggata-----cttataaggagattt
A0A2K6DS80_BCL2A1-      ---agcgaattgccccggatgt---ggata-----cttataaggagattt
A0A2K6CIX3_BCL2-01      ---gagatgtcgcccctggtg----gacaacatcgccctgtggatgactg
A0A2K6EA73_BCL2L2-      ---gagatggaaccactggtg----ggaca---agtgcaggagtggatgg
A0A2K6EA73_BCL2L2-      ---gagatggaaccactggtg----ggaca---agtgcaggagtggatgg
A0A2K6B2D9_BCL2L10      ---gagagagagccgctggtgac----------agcctggtggaagaagc
A0A2K6ECR0_MCL1-02      ttcgggagcaggccaccggcgccaaggacacaaagccaatgggcaggtct
A0A2K6ECR0_MCL1-03      ----------ggccaccggcgccaaggacacaaagccaatgggcaggtct
A0A2K6ECR0_MCL1-01      ttcgggagcaggccaccggcgccaaggacacaaagccaatgggcaggtct
                                    ** * *  *                     *  *    

A0A2K6DS80_BCL2A1-      cgtatttt-----gttgctgagttcataatgaataacaca-------gga
A0A2K6DS80_BCL2A1-      cgtatttt-----gttgctgagttcataatgaataacaca-------gga
A0A2K6CIX3_BCL2-01      ag---tacc---------tgaaccggcacctg---------------cac
A0A2K6EA73_BCL2L2-      tggcctacc---------tggagacgcggctg---------------gct
A0A2K6EA73_BCL2L2-      tggcctacc---------tggagacgcggctg---------------gct
A0A2K6B2D9_BCL2L10      ggggcttccagccgcggctgaaggagcaggag---------------ggc
A0A2K6ECR0_MCL1-02      ggggccaccagcag-----gaaggctctggagaccttacgacgggttggg
A0A2K6ECR0_MCL1-03      ggggccaccagcag-----gaaggctctggagaccttacgacgggttggg
A0A2K6ECR0_MCL1-01      ggggccaccagcag-----gaaggctctggagaccttacgacgggttggg
                         *                 *                              

A0A2K6DS80_BCL2A1-      gaatggataaggcaaaacggaggctggggg--------------------
A0A2K6DS80_BCL2A1-      gaatggataaggcaaaacggaggct-ggga--------------------
A0A2K6CIX3_BCL2-01      acctggatccaggataacggaggctgggac------gcctt---------
A0A2K6EA73_BCL2L2-      gactggatccacagcagtgggggctgggcg------gagtt-cacagctc
A0A2K6EA73_BCL2L2-      gactggatccacagcagtgggggctgggagctggaagctat-caaagctc
A0A2K6B2D9_BCL2L10      gacgtcgcccgggactgccagcgcctggtg------gccttgctgagctc
A0A2K6ECR0_MCL1-02      gatggcgtgcag---cgcaaccacgagacg------gccttccaa-----
A0A2K6ECR0_MCL1-03      gatggcgtgcag---cgcaaccacgagacg------gccttccaaggcat
A0A2K6ECR0_MCL1-01      gatggcgtgcag---cgcaaccacgagacg------gccttccaaggcat
                                               *  *                       

A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A2K6EA73_BCL2L2-      tatacgggg---------------------------------------ac
A0A2K6EA73_BCL2L2-      gagtcagggagatggaggaagaagctgagaagctaaaggagctacagaac
A0A2K6B2D9_BCL2L10      gc------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2K6ECR0_MCL1-03      gcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctc
A0A2K6ECR0_MCL1-01      gcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctc

A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A2K6EA73_BCL2L2-      gggg----------------------------------------------
A0A2K6EA73_BCL2L2-      gaggta--------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2K6ECR0_MCL1-03      gagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggatt
A0A2K6ECR0_MCL1-01      gagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggatt

A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2K6ECR0_MCL1-03      gtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccat
A0A2K6ECR0_MCL1-01      gtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccat

A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------gagaagcagatgaatatgagtcca
A0A2K6B2D9_BCL2L10      -----------------------------------------------ggc
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2K6ECR0_MCL1-03      aaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttc
A0A2K6ECR0_MCL1-01      aaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttc

A0A2K6DS80_BCL2A1-      -------------------------------------------aaatggc
A0A2K6DS80_BCL2A1-      -------------------------------------------aaatggc
A0A2K6CIX3_BCL2-01      -tgtggaactgtacggccccagcat--------------------gcggc
A0A2K6EA73_BCL2L2-      -------------------------------ccctggaggaggcg-cggc
A0A2K6EA73_BCL2L2-      cctccaggcaatgctggcccagtgatcatgtccattgaggagaagatgga
A0A2K6B2D9_BCL2L10      tcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggc
A0A2K6ECR0_MCL1-02      -------------------------------------------ggatggg
A0A2K6ECR0_MCL1-03      tcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatggg
A0A2K6ECR0_MCL1-01      tcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatggg

A0A2K6DS80_BCL2A1-      -------acaatcaca----------------------------------
A0A2K6DS80_BCL2A1-      tttgtaaagaagtttg----------------------------------
A0A2K6CIX3_BCL2-01      ctctgtttgatttctc----------------------------------
A0A2K6EA73_BCL2L2-      gtctg------------------------------------------cgg
A0A2K6EA73_BCL2L2-      ggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacag
A0A2K6B2D9_BCL2L10      ttttgtcacttcttca----------------------------------
A0A2K6ECR0_MCL1-02      tttgtggagttcttccat-------------------------------g
A0A2K6ECR0_MCL1-03      tttgtggagttcttccat-------------------------------g
A0A2K6ECR0_MCL1-01      tttgtggagttcttccat-------------------------------g

A0A2K6DS80_BCL2A1-      -----tgcct----------------------------------------
A0A2K6DS80_BCL2A1-      -----aacct----------------------------------------
A0A2K6CIX3_BCL2-01      --------ctgg--------------------------------------
A0A2K6EA73_BCL2L2-      gaggggaactgg--------------------------------------
A0A2K6EA73_BCL2L2-      cagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgtt
A0A2K6B2D9_BCL2L10      -ggagcccctttccgctg--------------------------------
A0A2K6ECR0_MCL1-02      tagaggacctagaaggtg--------------------------------
A0A2K6ECR0_MCL1-03      tagaggacctagaaggtg--------------------------------
A0A2K6ECR0_MCL1-01      tagaggacctagaaggtg--------------------------------

A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A2K6EA73_BCL2L2-      --------------------------------------------------
A0A2K6EA73_BCL2L2-      accatactctgtgacaaatttagtggccatcccaaaggatttgcgtatat
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-01      --------------------------------------------------

A0A2K6DS80_BCL2A1-      ----------------atg-ctagtagagt--------------------
A0A2K6DS80_BCL2A1-      ----------------aaatctggctggat--------------------
A0A2K6CIX3_BCL2-01      ----------------ctgtctctgaagac--------------------
A0A2K6EA73_BCL2L2-      ----------------gcatcagtgaggac--------------------
A0A2K6EA73_BCL2L2-      agagttctcagacaaagagtcagtgaggacttccttggccttagatgagt
A0A2K6B2D9_BCL2L10      ----------------gctttttggagaaa--------------------
A0A2K6ECR0_MCL1-02      ----------------gcatc----agaaa--------------------
A0A2K6ECR0_MCL1-03      ----------------gcatc----agaaa--------------------
A0A2K6ECR0_MCL1-01      ----------------gcatc----agaaa--------------------

A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6DS80_BCL2A1-      --------------------------------------------------
A0A2K6CIX3_BCL2-01      -------------------------tctg---------------------
A0A2K6EA73_BCL2L2-      -------------------------agtg---------------------
A0A2K6EA73_BCL2L2-      ccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacaga
A0A2K6B2D9_BCL2L10      -------------------------actg---------------------
A0A2K6ECR0_MCL1-02      -------------------------tgtg---------------------
A0A2K6ECR0_MCL1-03      -------------------------tgtg---------------------
A0A2K6ECR0_MCL1-01      -------------------------tgtg---------------------

A0A2K6DS80_BCL2A1-      ------------------------cagtggcccacaa-------------
A0A2K6DS80_BCL2A1-      ------------------------gacttttctagaa-------------
A0A2K6CIX3_BCL2-01      ----------------ctcagtttggccctggtggga-------------
A0A2K6EA73_BCL2L2-      ----------------ctgacggggg------------------------
A0A2K6EA73_BCL2L2-      ccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgc
A0A2K6B2D9_BCL2L10      ----------------ctgatccaggctttcctggca-------------
A0A2K6ECR0_MCL1-02      ----------------ctg--ctggcttttgcaggtg-------------
A0A2K6ECR0_MCL1-03      ----------------ctg--ctggcttttgcaggtg-------------
A0A2K6ECR0_MCL1-01      ----------------ctg--ctggcttttgcaggtg-------------

A0A2K6DS80_BCL2A1-      --------------------------------------------gaagaa
A0A2K6DS80_BCL2A1-      --------------------------------------------gttaca
A0A2K6CIX3_BCL2-01      ----------------------------------------gcttgcatca
A0A2K6EA73_BCL2L2-      ---------------------------------------ccgtggc----
A0A2K6EA73_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
A0A2K6B2D9_BCL2L10      ---------------------------------------tgcttg--tta
A0A2K6ECR0_MCL1-02      ---------------------------------------ttgctggagta
A0A2K6ECR0_MCL1-03      ---------------------------------------ttgctggagta
A0A2K6ECR0_MCL1-01      ---------------------------------------ttgctggagta

A0A2K6DS80_BCL2A1-      gaaaatggctttgtaa----------------------------------
A0A2K6DS80_BCL2A1-      ggaaagatctgtgaaatgctctctcttctgaagcaatactgt--------
A0A2K6CIX3_BCL2-01      --------ccctg----ggtgcctatctgggcc-----------------
A0A2K6EA73_BCL2L2-      actgggggccctg-----gtaactgtaggggcc-----------------
A0A2K6EA73_BCL2L2-      acagcaggccccggggtcgtgtctacaggggccgggctagagcgacatca
A0A2K6B2D9_BCL2L10      gcaacagccttcg----gttatct--ctggacacgattatta--------
A0A2K6ECR0_MCL1-02      ggagctggtttgg----catatctaataagatagccttactg--------
A0A2K6ECR0_MCL1-03      ggagctggtttgg----catatctaataagatag----------------
A0A2K6ECR0_MCL1-01      ggagctggtttgg----catatctaataagatag----------------

A0A2K6DS80_BCL2A1-      ---------------------
A0A2K6DS80_BCL2A1-      ------------------tga
A0A2K6CIX3_BCL2-01      -------------acaagtga
A0A2K6EA73_BCL2L2-      ---ttttttgctagcaagtga
A0A2K6EA73_BCL2L2-      tggtattccccttac---taa
A0A2K6B2D9_BCL2L10      ------------------tga
A0A2K6ECR0_MCL1-02      ------------------taa
A0A2K6ECR0_MCL1-03      ---------------------
A0A2K6ECR0_MCL1-01      ---------------------

© 1998-2019