Dataset for CDS MCL-1 of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7HUE9_MCL1-02      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
F7HUE9_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
                    ************************************************************

F7HUE9_MCL1-02      ttgggggccggcagcggcggcgccacccctccgggagggcggctttt-------------
F7HUE9_MCL1-01      ttgggggccggcagcggcggcgccacccctccgggagggcggcttttggctacggagaag
                    ***********************************************             

F7HUE9_MCL1-02      ------------------------------------------------------------
F7HUE9_MCL1-01      gaggcctcggcccggcgagagatagggggaggggaggccggcacggtgattggcggaagc
                                                                                

F7HUE9_MCL1-02      ------------------------------------------------------------
F7HUE9_MCL1-01      gccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
                                                                                

F7HUE9_MCL1-02      ------------------------------------------------------------
F7HUE9_MCL1-01      cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcg
                                                                                

F7HUE9_MCL1-02      ------------------------------------------------------------
F7HUE9_MCL1-01      cccacccgccgcgcgtcgccgcttgaggagatggaagccccggccgccgacgccatcatg
                                                                                

F7HUE9_MCL1-02      ------------------------------------------------------------
F7HUE9_MCL1-01      tcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
                                                                                

F7HUE9_MCL1-02      ------------------------------------------------------------
F7HUE9_MCL1-01      ctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
                                                                                

F7HUE9_MCL1-02      ------------------------------------------------------------
F7HUE9_MCL1-01      ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
                                                                                

F7HUE9_MCL1-02      --------------------------ggccaccggcgccaaggacacaaagccaatgggc
F7HUE9_MCL1-01      attatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
                                              **********************************

F7HUE9_MCL1-02      aggtctggggccaccagcaggaaggctctggagaccttacgacgggttggggatggcgtg
F7HUE9_MCL1-01      aggtctggggccaccagcaggaaggctctggagaccttacgacgggttggggatggcgtg
                    ************************************************************

F7HUE9_MCL1-02      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
F7HUE9_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
                    ************************************************************

F7HUE9_MCL1-02      gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaac
F7HUE9_MCL1-01      gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaac
                    ************************************************************

F7HUE9_MCL1-02      tggggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagacc
F7HUE9_MCL1-01      tggggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagacc
                    ************************************************************

F7HUE9_MCL1-02      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
F7HUE9_MCL1-01      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
                    ************************************************************

F7HUE9_MCL1-02      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
F7HUE9_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
                    ************************************************************

F7HUE9_MCL1-02      gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgga
F7HUE9_MCL1-01      gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgga
                    ************************************************************

F7HUE9_MCL1-02      gtaggagctggtttggcatatctaataagatag
F7HUE9_MCL1-01      gtaggagctggtttggcatatctaataagatag
                    *********************************

© 1998-2019