Dataset for CDS BCL-2-like of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-04        atgccccttctgattctctctccatatattcatgccagtgtttcatcctt
F7G4L5_BCL2L2-05        --------------------------------------------------

F7E8V5_BCL2A1-01        -------------------atgacagactgtg------------------
F7E8V5_BCL2A1-02        -------------------atgacagactgtg------------------
A0A1D5QRF2_BCL2-01      -------------------atggcgcacgctgggagaac--agggtacga
F7H6U5_BCL2L10-01       -------------------atggctgaccc-------gttgcgg-gagcg
F7HUE9_MCL1-02          -------------------atgtttggcctcaaaagaaacgcggtaatcg
F7HUE9_MCL1-01          -------------------atgtttggcctcaaaagaaacgcggtaatcg
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        ----------------------------------atgtctcaga-----g
F7G4L5_BCL2L2-03        -------------------atggcgaccccagcctcggccccag-----a
F7G4L5_BCL2L2-02        -------------------atggcgaccccagcctcggccccag-----a
F7G4L5_BCL2L2-04        gcctcttatagctgcccggatggcgaccccagcctcggccccag-----a
F7G4L5_BCL2L2-05        -------------------atggcgaccccagcctcggccccag-----a

F7E8V5_BCL2A1-01        -aatttggatatatt-----------------------tacaggctagct
F7E8V5_BCL2A1-02        -aatttggatatatt-----------------------tacaggctagct
A0A1D5QRF2_BCL2-01      taaccgggagatagt-------gatgaagtacatccactataagctgtcg
F7H6U5_BCL2L10-01       caccgagcggctcct-------ggccgact-----------atc------
F7HUE9_MCL1-02          gactcaacctctactgtgggggggccggcttgggggccggcagc------
F7HUE9_MCL1-01          gactcaacctctactgtgggggggccggcttgggggccggcagc------
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        caaccgggagctggt-------ggttgactttctctcctacaagctttcc
F7G4L5_BCL2L2-03        cacacgggctctggt-------ggcagactttgtaggttataagctgagg
F7G4L5_BCL2L2-02        cacacgggctctggt-------ggcagactttgtaggttataagctgagg
F7G4L5_BCL2L2-04        cacacgggctctggt-------ggcagactttgtaggttataagctgagg
F7G4L5_BCL2L2-05        cacacgggctctggt-------ggcagactttgtaggttataagctgagg

F7E8V5_BCL2A1-01        caggactatt----------------------tgcagtacgttctgcaga
F7E8V5_BCL2A1-02        caggactatt----------------------tgcagtacgttctgcaga
A0A1D5QRF2_BCL2-01      cagaggggctacgagtggga------------tgcgggggatgtgggcgc
F7H6U5_BCL2L10-01       --------------------------------tggggt----------gc
F7HUE9_MCL1-02          --------------------------------ggcggc----------gc
F7HUE9_MCL1-01          --------------------------------ggcggc----------gc
F6UKR4_BCL2L1-02        -------------------------------atgtggaagagaacaggac
F6UKR4_BCL2L1-01        cagaaaggatacagctggagtcaatttagtgatgtggaagagaacaggac
F7G4L5_BCL2L2-03        cagaagggttatgtc-----------------tgtgga----------gc
F7G4L5_BCL2L2-02        cagaagggttatgtc-----------------tgtgga----------gc
F7G4L5_BCL2L2-04        cagaagggttatgtc-----------------tgtgga----------gc
F7G4L5_BCL2L2-05        cagaagggttatgtc-----------------tgtgga----------gc
                                                         *  *             

F7E8V5_BCL2A1-01        taccacaacctggatcgggtcc----------------------------
F7E8V5_BCL2A1-02        taccacaacctggatcgggtcc----------------------------
A0A1D5QRF2_BCL2-01      ggcgacccctggggc-cgcccc----------------------------
F7H6U5_BCL2L10-01       tgcgc--ccgggaacccggc------------------------------
F7HUE9_MCL1-02          cacccctccgggagggcggctttt--------------------------
F7HUE9_MCL1-01          cacccctccgggagggcggcttttggctacggagaaggaggcctcggccc
F6UKR4_BCL2L1-02        tgaggccccagaagg--gactg----------------------------
F6UKR4_BCL2L1-01        tgaggccccagaagg--gactg----------------------------
F7G4L5_BCL2L2-03        t--ggccccggggag--ggccc----------------------------
F7G4L5_BCL2L2-02        t--ggccccggggag--ggccc----------------------------
F7G4L5_BCL2L2-04        t--ggccccggggag--ggccc----------------------------
F7G4L5_BCL2L2-05        t--ggccccggggag--ggccc----------------------------
                                *        *                                

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          ggcgagagatagggggaggggaggccggcacggtgattggcggaagcgcc
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          ggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcg
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          gccgccgcccattggcgcggaggtccccgacgtcaccgcgagccccgcga
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          ggctgcttttctttgcgcccacccgccgcgcgtcgccgcttgaggagatg
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          gaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgg
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          gtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctgg
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          agttggtcggggaatctggtaatagccccagtacggatgggtcactaccc
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      -----------------------------------------------cgc
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          tcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtc
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------

F7E8V5_BCL2A1-01        -------------------------aagcaaaacgtccagagtgctacaa
F7E8V5_BCL2A1-02        -------------------------aagcaaaacgtccagagtgctacaa
A0A1D5QRF2_BCL2-01      accgggcatcttctcctcccagcccgggcacacgccccatcccgccgcgt
F7H6U5_BCL2L10-01       --------------------acccctgagccaaggccgtccacgcc----
F7HUE9_MCL1-02          ---------------------------------ggccaccggcgccaagg
F7HUE9_MCL1-01          gctggagattatctctcggtaccttcgggagcaggccaccggcgccaagg
F6UKR4_BCL2L1-02        --------------------aatcggagatggagacccccagtgccatca
F6UKR4_BCL2L1-01        --------------------aatcggagatggagacccccagtgccatca
F7G4L5_BCL2L2-03        --------------------a---gcagct---gacccgctgcac-----
F7G4L5_BCL2L2-02        --------------------a---gcagct---gacccgctgcac-----
F7G4L5_BCL2L2-04        --------------------a---gcagct---gacccgctgcac-----
F7G4L5_BCL2L2-05        --------------------a---gcagct---gacccgctgcac-----
                                                            *       *     

F7E8V5_BCL2A1-01        a-------------------------------------------------
F7E8V5_BCL2A1-02        a-------------------------------------------------
A0A1D5QRF2_BCL2-01      cccgggacccggtcgccaggacctcgccgctgccgaccccggctgccccc
F7H6U5_BCL2L10-01       ---cgaggccgcc-------------------------------------
F7HUE9_MCL1-02          acacaaagccaat-------------------------------------
F7HUE9_MCL1-01          acacaaagccaat-------------------------------------
F6UKR4_BCL2L1-02        atggcaacccatcct-----------------------------------
F6UKR4_BCL2L1-01        atggcaacccatcctggcacctggtggacagccccgcggtgaatggagcc
F7G4L5_BCL2L2-03        ----caagccatgcgggca-------------------------------
F7G4L5_BCL2L2-02        ----caagccatgcgggca-------------------------------
F7G4L5_BCL2L2-04        ----caagccatgcgggca-------------------------------
F7G4L5_BCL2L2-05        ----caagccatgcgggca-------------------------------

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      gccgccgccgccgccgcggggcctgcgctcagcccggtgcc---acctgt
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        actggccacagcagcagtttggatgcccgggaggtgatccccatggcagc
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-04        --------------------------------------------------
F7G4L5_BCL2L2-05        --------------------------------------------------

F7E8V5_BCL2A1-01        --------------------------aggttgcattctcagtccaaaaag
F7E8V5_BCL2A1-02        --------------------------aggttgcattctcagtccaaaaag
A0A1D5QRF2_BCL2-01      ggtccacctgaccctccgccaggccggtgacgacttctcccgccgcta--
F7H6U5_BCL2L10-01       --------------------------gtgctgcgctccgcggccgcca--
F7HUE9_MCL1-02          --------------------------gggc--aggtctggggccacca--
F7HUE9_MCL1-01          --------------------------gggc--aggtctggggccacca--
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        agtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggta--
F7G4L5_BCL2L2-03        ----------------------gctggagatgagttcgagacccgctt--
F7G4L5_BCL2L2-02        ----------------------gctggagatgagttcgagacccgctt--
F7G4L5_BCL2L2-04        ----------------------gctggagatgagttcgagacccgctt--
F7G4L5_BCL2L2-05        ----------------------gctggagatgagttcgagacccgctt--

F7E8V5_BCL2A1-01        aagtggaaaagaatctgaagccatgcttggacaatgttaatgttgcatcc
F7E8V5_BCL2A1-02        aagtggaaaagaatctgaagccatgcttggacaatgttaatgttgcatcc
A0A1D5QRF2_BCL2-01      ---ccgccgcgacttcgccgagatgtccagccagctg------------c
F7H6U5_BCL2L10-01       ---g------------------gttacgg--cagctc------------c
F7HUE9_MCL1-02          ---gcaggaaggctctggagaccttacga--cgggttggggatggcgtgc
F7HUE9_MCL1-01          ---gcaggaaggctctggagaccttacga--cgggttggggatggcgtgc
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        ---ccggcgggcgttcagtgacctgacatcccagctc------------c
F7G4L5_BCL2L2-03        ---ccggcgcaccttctctgatctggcggctcagctg------------c
F7G4L5_BCL2L2-02        ---ccggcgcaccttctctgatctggcggctcagctg------------c
F7G4L5_BCL2L2-04        ---ccggcgcaccttctctgatctggcggctcagctg------------c
F7G4L5_BCL2L2-05        ---ccggcgcaccttctctgatctggcggctcagctg------------c

F7E8V5_BCL2A1-01        at--------agacactgc----cagaacactattcaa------------
F7E8V5_BCL2A1-02        at--------agacactgc----cagaacactattcaa------------
A0A1D5QRF2_BCL2-01      acctgacgcccttcaccgcgcggggacgctttgccacg------------
F7H6U5_BCL2L10-01       accggtccttcttctccgcctaccgcggc-taccccgggaaccg------
F7HUE9_MCL1-02          agcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatc
F7HUE9_MCL1-01          agcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatc
F6UKR4_BCL2L1-02        -----------gggacagcatatcagagctttgaacag------------
F6UKR4_BCL2L1-01        acatcaccccagggacagcatatcagagctttgaacag------------
F7G4L5_BCL2L2-03        atgtgaccccaggctcagcacagcaacgcttcacccag------------
F7G4L5_BCL2L2-02        atgtgaccccaggctcagcacagcaacgcttcacccag------------
F7G4L5_BCL2L2-04        atgtgaccccaggctcagcacagcaacgcttcacccag------------
F7G4L5_BCL2L2-05        atgtgaccccaggctcagcacagcaacgcttcacccag------------
                                       * **         *                     

F7E8V5_BCL2A1-01        -----------------------------tcaagtgatggaaaaggagtt
F7E8V5_BCL2A1-02        -----------------------------tcaagtgatggaaaaggagtt
A0A1D5QRF2_BCL2-01      --------------------------gtggtggagga----------gct
F7H6U5_BCL2L10-01       --------------cgtcgagctggtggcgctgatggcggaggccgtgct
F7HUE9_MCL1-02          aaaaacgaagacgatgtcaaatctttgtctcgagtgatg--gtccatgtt
F7HUE9_MCL1-01          aaaaacgaagacgatgtcaaatctttgtctcgagtgatg--gtccatgtt
F6UKR4_BCL2L1-02        --------------------------gtagtgaatga----------act
F6UKR4_BCL2L1-01        --------------------------gtagtgaatga----------act
F7G4L5_BCL2L2-03        --------------------------gtctccgatga----------act
F7G4L5_BCL2L2-02        --------------------------gtctccgatga----------act
F7G4L5_BCL2L2-04        --------------------------gtctccgatga----------act
F7G4L5_BCL2L2-05        --------------------------gtctccgatga----------act
                                                           *             *

F7E8V5_BCL2A1-01        ------tgaagatggcatcattaactggggaagaattgtaaccatatttg
F7E8V5_BCL2A1-02        ------tgaagatggcatcattaactggggaagaattgtaaccatatttg
A0A1D5QRF2_BCL2-01      ctt---cagggacggggtgaa---ctgggggaggatcgtggccttctttg
F7H6U5_BCL2L10-01       ctccgacagccccggccccac---ctggggcagggtggtgtcgctggtga
F7HUE9_MCL1-02          tt----cagcgacggcgtaacaaactggggcaggattgtgactctcattt
F7HUE9_MCL1-01          tt----cagcgacggcgtaacaaactggggcaggattgtgactctcattt
F6UKR4_BCL2L1-02        ctt---ccgggatggggtaaa---ctggggtcgcattgtggcctttttct
F6UKR4_BCL2L1-01        ctt---ccgggatggggtaaa---ctggggtcgcattgtggcctttttct
F7G4L5_BCL2L2-03        ttt---ccaagggggccccaa---ctggggccgccttgtagccttctttg
F7G4L5_BCL2L2-02        ttt---ccaagggggccccaa---ctggggccgccttgtagccttctttg
F7G4L5_BCL2L2-04        ttt---ccaagggggccccaa---ctggggccgccttgtagccttctttg
F7G4L5_BCL2L2-05        ttt---ccaagggggccccaa---ctggggccgccttgtagccttctttg
                                     **    *    ******  *  * **  *  *  *  

F7E8V5_BCL2A1-01        catt-----------------------------tgaaggtattct-catc
F7E8V5_BCL2A1-02        catt-----------------------------tgaaggtattct-catc
A0A1D5QRF2_BCL2-01      agtt-----------------------------cggtggggtcatgtgtg
F7H6U5_BCL2L10-01       ccttcgcggggacgctgctggagagagagccgctggtg----acagcctg
F7HUE9_MCL1-02          cttt-----------------------------tggtg----cctttgtg
F7HUE9_MCL1-01          cttt-----------------------------tggtg----cctttgtg
F6UKR4_BCL2L1-02        cctt-----------------------------cggcggggcactgtgcg
F6UKR4_BCL2L1-01        cctt-----------------------------cggcggggcactgtgcg
F7G4L5_BCL2L2-03        tctt-----------------------------tggggctgcactgtgtg
F7G4L5_BCL2L2-02        tctt-----------------------------tggggctgcactgtgtg
F7G4L5_BCL2L2-04        tctt-----------------------------tggggctgcactgtgtg
F7G4L5_BCL2L2-05        tctt-----------------------------tggggctgcactgtgtg
                          **                              *  *            

F7E8V5_BCL2A1-01        aagaaacttctacgacagcgaattgccccggatgtggatacttataagga
F7E8V5_BCL2A1-02        aagaaacttctacgacagcgaattgccccggatgtggatacttataagga
A0A1D5QRF2_BCL2-01      tggaga--------gcgtcaaccgg---gagatgtcgcccctggtggaca
F7H6U5_BCL2L10-01       gtggaagaagcggggcttccagccg---cggctgaaggagcaggagggcg
F7HUE9_MCL1-02          gcgaaa-------------cacttg---aagaccataaaccaagaaagct
F7HUE9_MCL1-01          gcgaaa-------------cacttg---aagaccataaaccaagaaagct
F6UKR4_BCL2L1-02        tggaaa--------gcgtagacaag---gagatgcaggtattggtgagtc
F6UKR4_BCL2L1-01        tggaaa--------gcgtagacaag---gagatgcaggtattggtgagtc
F7G4L5_BCL2L2-03        ctgaga--------gtgtcaacaag---gagatggaaccactggtgggac
F7G4L5_BCL2L2-02        ctgaga--------gtgtcaacaag---gagatggaaccactggtgggac
F7G4L5_BCL2L2-04        ctgaga--------gtgtcaacaag---gagatggaaccactggtgggac
F7G4L5_BCL2L2-05        ctgaga--------gtgtcaacaag---gagatggaaccactggtgggac
                          *  *              *   *     *                   

F7E8V5_BCL2A1-01        gattt----------cgtattttgttgctgagttcataatgaataacaca
F7E8V5_BCL2A1-02        gattt----------cgtattttgttgctgagttcataatgaataacaca
A0A1D5QRF2_BCL2-01      acatc---------gccctgtggatgactgagtacctgaaccggcacctg
F7H6U5_BCL2L10-01       acgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggctc
F7HUE9_MCL1-02          gcatc-----gaaccattagca---gaaagtatcacagacgtt----ctc
F7HUE9_MCL1-01          gcatc-----gaaccattagca---gaaagtatcacagacgtt----ctc
F6UKR4_BCL2L1-02        ggatc---------gcagcttggatggccacttacctgaatgaccaccta
F6UKR4_BCL2L1-01        ggatc---------gcagcttggatggccacttacctgaatgaccaccta
F7G4L5_BCL2L2-03        aagtg---------caggagtggatggtggcctacctggagacgcggctg
F7G4L5_BCL2L2-02        aagtg---------caggagtggatggtggcctacctggagacgcggctg
F7G4L5_BCL2L2-04        aagtg---------caggagtggatggtggcctacctggagacgcggctg
F7G4L5_BCL2L2-05        aagtg---------caggagtggatggtggcctacctggagacgcggctg
                           *                            *                 

F7E8V5_BCL2A1-01        gg------------agaatggataaggcaaaacggaggctggga------
F7E8V5_BCL2A1-02        gg------------agaatggataaggcaaaacggaggctgggg------
A0A1D5QRF2_BCL2-01      ca------------cacctggatccaggataacggaggctgggt------
F7H6U5_BCL2L10-01       gcggggcagcaccgcgcctggcttcaggctcagggcggctg---------
F7HUE9_MCL1-02          gtaaggacaaaacgggactggctagttaaacaaagaggctg---------
F7HUE9_MCL1-01          gtaaggacaaaacgggactggctagttaaacaaagaggctg---------
F6UKR4_BCL2L1-02        ga------------gccttggatccaggagaacggcggctg---------
F6UKR4_BCL2L1-01        ga------------gccttggatccaggagaacggcggctg---------
F7G4L5_BCL2L2-03        gc------------tgactggatccacagcagtgggggctgggc------
F7G4L5_BCL2L2-02        gc------------tgactggatccacagcagtgggggctgggc------
F7G4L5_BCL2L2-04        gc------------tgactggatccacagcagtgggggctggttatccca
F7G4L5_BCL2L2-05        gc------------tgactggatccacagcagtgggggctg---------
                                          *** *           * *****         

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-04        gatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaa
F7G4L5_BCL2L2-05        --------------------------------------------------

F7E8V5_BCL2A1-01        -------------------------------------------aaatggc
F7E8V5_BCL2A1-02        -------------------------------------------gaa----
A0A1D5QRF2_BCL2-01      -------------------------------------------aggtgca
F7H6U5_BCL2L10-01       -------------------------------------------ggatggc
F7HUE9_MCL1-02          -------------------------------------------ggatggg
F7HUE9_MCL1-01          -------------------------------------------ggatggg
F6UKR4_BCL2L1-02        -------------------------------------------ggacact
F6UKR4_BCL2L1-01        -------------------------------------------ggacact
F7G4L5_BCL2L2-03        -------------------------------------ggagt--------
F7G4L5_BCL2L2-02        -------------------------------------ggagt--------
F7G4L5_BCL2L2-04        gcgactgtgactctgctccaagttccccagatctcgaggagctggaagct
F7G4L5_BCL2L2-05        -------------------------------------ggagctggaagct

F7E8V5_BCL2A1-01        tttgtaaagaagtttgaac-------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      cttggtgatgtgagtctgg-------------------------------
F7H6U5_BCL2L10-01       ttttgtcacttcttca----------------------------------
F7HUE9_MCL1-02          tttgtggagttcttccatg-------------------------------
F7HUE9_MCL1-01          tttgtggagttcttccatg-------------------------------
F6UKR4_BCL2L1-02        tttgtggaactctatggga-------------------------------
F6UKR4_BCL2L1-01        tttgtggaactctatggga-------------------------------
F7G4L5_BCL2L2-03        -tcacagctctatacgggg-------------------------------
F7G4L5_BCL2L2-02        -tcacagctctatacgggg-------------------------------
F7G4L5_BCL2L2-04        atcaaagctcgagtcagggagatggaggaagaagctgagaagctaaagga
F7G4L5_BCL2L2-05        atcaaagctcgagtcagggagatggaggaagaagctgagaagctaaagga

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
F6UKR4_BCL2L1-02        --------acaatg------------------------------------
F6UKR4_BCL2L1-01        --------acaatg------------------------------------
F7G4L5_BCL2L2-03        --------acgggg------------------------------------
F7G4L5_BCL2L2-02        --------acgggg------------------------------------
F7G4L5_BCL2L2-04        gctacagaacgaggtagagaagcagatgaatatgagtccacctccaggca
F7G4L5_BCL2L2-05        gctacagaacgaggtagagaagcagatgaatatgagtccacctccaggca

F7E8V5_BCL2A1-01        ------------------------------------ctaaatctg-----
F7E8V5_BCL2A1-02        ------------------------------------------atg-----
A0A1D5QRF2_BCL2-01      --------------------------gctggggccacaggttcga-----
F7H6U5_BCL2L10-01       ----------------------------ggagcccctttccgctg-----
F7HUE9_MCL1-02          ---------------------------tagaggacctagaaggtg-----
F7HUE9_MCL1-01          ---------------------------tagaggacctagaaggtg-----
F6UKR4_BCL2L1-02        ------------------------------------cagcagccg-----
F6UKR4_BCL2L1-01        ------------------------------------cagcagccg-----
F7G4L5_BCL2L2-03        ---------------------ccctggaggaggcg-cggcgtctg-----
F7G4L5_BCL2L2-02        ---------------------ccctggaggaggcg-cggcgtctg-----
F7G4L5_BCL2L2-04        atgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcc
F7G4L5_BCL2L2-05        atgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcc

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      ------------------------------ggtgcgggggttggagtgcg
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------agagcc
F6UKR4_BCL2L1-01        --------------------------------------------agagcc
F7G4L5_BCL2L2-03        -------------------------------------cgggaggggaact
F7G4L5_BCL2L2-02        -------------------------------------cgggaggggaact
F7G4L5_BCL2L2-04        cgttccatctatgttggcaatgtggactatggtgcaacagcagaagagct
F7G4L5_BCL2L2-05        cgttccatctatgttggcaatgtggactatggtgcaacagcagaagagct

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      ggtgggctcct---------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
F6UKR4_BCL2L1-02        ga------------------------------------------------
F6UKR4_BCL2L1-01        ga------------------------------------------------
F7G4L5_BCL2L2-03        gg------------------------------------------------
F7G4L5_BCL2L2-02        gg------------------------------------------------
F7G4L5_BCL2L2-04        ggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactct
F7G4L5_BCL2L2-05        ggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactct

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-02          --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
F6UKR4_BCL2L1-02        --------------------------------------------------
F6UKR4_BCL2L1-01        --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-04        gtgacaaatttagtggccatcctaaaggatttgcgtatatagagttctca
F7G4L5_BCL2L2-05        gtgacaaatttagtggccatcctaaaggatttgcgtatatagagttctca

F7E8V5_BCL2A1-01        ------gctgga--------------------------------------
F7E8V5_BCL2A1-02        ------gcacaa--------------------------------------
A0A1D5QRF2_BCL2-01      ------ggggcaaggggagg------------------------------
F7H6U5_BCL2L10-01       ------gctttttggagaaa------------------------------
F7HUE9_MCL1-02          ------gcatc----agaaa------------------------------
F7HUE9_MCL1-01          ------gcatc----agaaa------------------------------
F6UKR4_BCL2L1-02        ----aagggccag-gagcgcttcaaccgc---------------------
F6UKR4_BCL2L1-01        ----aagggccag-gagcgcttcaaccgc---------------------
F7G4L5_BCL2L2-03        ------gcatcagtgaggac------------------------------
F7G4L5_BCL2L2-02        ------gcatcagtgaggac------------------------------
F7G4L5_BCL2L2-04        gacaaagagtcagtgaggacttccttggccttagatgagtccctatttag
F7G4L5_BCL2L2-05        gacaaagagtcagtgaggacttccttggccttagatgagtccctatttag

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       ---------------actg-------------------------------
F7HUE9_MCL1-02          ---------------tgtg-------------------------------
F7HUE9_MCL1-01          ---------------tgtg-------------------------------
F6UKR4_BCL2L1-02        -----------------tggttc---------------------------
F6UKR4_BCL2L1-01        -----------------tggttc---------------------------
F7G4L5_BCL2L2-03        ---------------agtg-------------------------------
F7G4L5_BCL2L2-02        ---------------agtg-------------------------------
F7G4L5_BCL2L2-04        aggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatca
F7G4L5_BCL2L2-05        aggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatca

F7E8V5_BCL2A1-01        --------------------------------------------------
F7E8V5_BCL2A1-02        --------------------------------------------------
A0A1D5QRF2_BCL2-01      ------ctg-----------------------------------------
F7H6U5_BCL2L10-01       ------ctgatc--------------------------------------
F7HUE9_MCL1-02          ------ctg--c--------------------------------------
F7HUE9_MCL1-01          ------ctg--c--------------------------------------
F6UKR4_BCL2L1-02        ------ctgacgggca----------------------------------
F6UKR4_BCL2L1-01        ------ctgacgggca----------------------------------
F7G4L5_BCL2L2-03        ------ctgacggggg----------------------------------
F7G4L5_BCL2L2-02        ------ctgacggggg----------------------------------
F7G4L5_BCL2L2-04        gcacaacagaccggggttttccacgagcccgctaccgcgcccggaccacc
F7G4L5_BCL2L2-05        gcacaacagaccggggttttccacgagcccgctaccgcgcccggaccacc

F7E8V5_BCL2A1-01        --------------------------------tgacttttct-agaagtt
F7E8V5_BCL2A1-02        --------------------------------tcacatgcct-a-----t
A0A1D5QRF2_BCL2-01      --------------------------------tggagccggcgaaataaa
F7H6U5_BCL2L10-01       --------------------------------caggctttcc-tggcatg
F7HUE9_MCL1-02          --------------------------------tggcttttgc-aggtgtt
F7HUE9_MCL1-01          --------------------------------tggcttttgc-aggtgtt
F6UKR4_BCL2L1-02        --------------------------tgactgtggc--------------
F6UKR4_BCL2L1-01        --------------------------tgactgtggc--------------
F7G4L5_BCL2L2-03        -----------------------------ccgtggc----ac-tgggggc
F7G4L5_BCL2L2-02        -----------------------------ccgtggc----ac-tgggggc
F7G4L5_BCL2L2-04        aactacaacagttcccgctctcgattctacagtggttttaac-agcaggc
F7G4L5_BCL2L2-05        aactacaacagttcccgctctcgattctacagtggttttaac-agcaggc

F7E8V5_BCL2A1-01        acaggaaagatctgtgaaatgcta-------------------tctctcc
F7E8V5_BCL2A1-02        gctagtagagtcagtggcccacta-------------------g------
A0A1D5QRF2_BCL2-01      atcagggttgttgcttcccggcgt----------------ccctacctct
F7H6U5_BCL2L10-01       cttg--ttagcaacagccttcggt-------------------tatctct
F7HUE9_MCL1-02          gctggagtaggagctggtttggca-------------------tatct--
F7HUE9_MCL1-01          gctggagtaggagctggtttggca-------------------tatct--
F6UKR4_BCL2L1-02        --cggcgtggt-tctgctgggctc-------------------actcttc
F6UKR4_BCL2L1-01        --cggcgtggt-tctgctgggctc-------------------actcttc
F7G4L5_BCL2L2-03        cctg-----gtaactgtaggggcc--------------------tttttt
F7G4L5_BCL2L2-02        cctg-----gtaactgtaggggcc--------------------tttttt
F7G4L5_BCL2L2-04        cccggggtcgtgtctacaggggccgggctagagcgacatcatggtattcc
F7G4L5_BCL2L2-05        cccggggtcgtgtctacaggggccgggctagagcgacatcatggtattcc

F7E8V5_BCL2A1-01        tgaagcaatactgttga
F7E8V5_BCL2A1-02        -----------------
A0A1D5QRF2_BCL2-01      tcctctggataa-----
F7H6U5_BCL2L10-01       ggacacgattattatga
F7HUE9_MCL1-02          -------aataagatag
F7HUE9_MCL1-01          -------aataagatag
F6UKR4_BCL2L1-02        agtcggaaatga-----
F6UKR4_BCL2L1-01        agtcggaaatga-----
F7G4L5_BCL2L2-03        gctagcaagtga-----
F7G4L5_BCL2L2-02        gctagcaagtga-----
F7G4L5_BCL2L2-04        ccttac---taa-----
F7G4L5_BCL2L2-05        ccttac---taa-----

© 1998-2019