Dataset for CDS BCL2L2 of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7G4L5_BCL2L2-02      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
F7G4L5_BCL2L2-01      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
                      **************************************************

F7G4L5_BCL2L2-02      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
F7G4L5_BCL2L2-01      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
                      **************************************************

F7G4L5_BCL2L2-02      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
F7G4L5_BCL2L2-01      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
                      **************************************************

F7G4L5_BCL2L2-02      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
F7G4L5_BCL2L2-01      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
                      **************************************************

F7G4L5_BCL2L2-02      gctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccg
F7G4L5_BCL2L2-01      gctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccg
                      **************************************************

F7G4L5_BCL2L2-02      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt
F7G4L5_BCL2L2-01      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt
                      **************************************************

F7G4L5_BCL2L2-02      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
F7G4L5_BCL2L2-01      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
                      **************************************************

F7G4L5_BCL2L2-02      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
F7G4L5_BCL2L2-01      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
                      **************************************************

F7G4L5_BCL2L2-02      tggctgactggatccacagcagtgggggctgggagctggaagctatcaaa
F7G4L5_BCL2L2-01      tggctgactggatccacagcagtgggggctgggcg------gagttcaca
                      ********************************* *      *   *** *

F7G4L5_BCL2L2-02      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
F7G4L5_BCL2L2-01      gctctatacgggg-------------------------------------
                      **** *  * ***                                     

F7G4L5_BCL2L2-02      gaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctg
F7G4L5_BCL2L2-01      --acgggg------------------------------------------
                        *** **                                          

F7G4L5_BCL2L2-02      gcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttcc
F7G4L5_BCL2L2-01      ---------------ccctggaggaggcg-cggcgtctg-----------
                                     ** * ******  *  ** * ***           

F7G4L5_BCL2L2-02      atctatgttggcaatgtggactatggtgcaacagcagaagagctggaagc
F7G4L5_BCL2L2-01      -------------------------------cgggaggggaactgg----
                                                     * * **  ** ****    

F7G4L5_BCL2L2-02      tcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgaca
F7G4L5_BCL2L2-01      --------------------------------------------------
                                                                        

F7G4L5_BCL2L2-02      aatttagtggccatcccaaaggatttgcgtatatagagttctcagacaaa
F7G4L5_BCL2L2-01      --------------------------------------------------
                                                                        

F7G4L5_BCL2L2-02      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
F7G4L5_BCL2L2-01      gcatcagtgaggac------------------------------------
                      *  ***********                                    

F7G4L5_BCL2L2-02      gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
F7G4L5_BCL2L2-01      ---------agtg-------------------------------------
                                ***                                     

F7G4L5_BCL2L2-02      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
F7G4L5_BCL2L2-01      ctgacggggg----------------------------------------
                      * *** ****                                        

F7G4L5_BCL2L2-02      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
F7G4L5_BCL2L2-01      -----------------------ccgtggc----actgggggccctg---
                                             * ****     ** *  ***** *   

F7G4L5_BCL2L2-02      tcgtgtctacaggggccgggctagagcgacatcatggtattccccttac-
F7G4L5_BCL2L2-01      --gtaactgtaggggcc--------------------ttttttgctagca
                        **  **  *******                    * **   **  * 

F7G4L5_BCL2L2-02      --taa
F7G4L5_BCL2L2-01      agtga
                        * *

© 1998-2019