Dataset for CDS BCL2L2 of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7G4L5_BCL2L2-02      --------------------------------------------------
F7G4L5_BCL2L2-03      --------------------------------------------------
F7G4L5_BCL2L2-05      --------------------------------------------------
F7G4L5_BCL2L2-04      atgccccttctgattctctctccatatattcatgccagtgtttcatcctt
                                                                        

F7G4L5_BCL2L2-02      -------------------atggcgaccccagcctcggccccagacacac
F7G4L5_BCL2L2-03      -------------------atggcgaccccagcctcggccccagacacac
F7G4L5_BCL2L2-05      -------------------atggcgaccccagcctcggccccagacacac
F7G4L5_BCL2L2-04      gcctcttatagctgcccggatggcgaccccagcctcggccccagacacac
                                         *******************************

F7G4L5_BCL2L2-02      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
F7G4L5_BCL2L2-03      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
F7G4L5_BCL2L2-05      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
F7G4L5_BCL2L2-04      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
                      **************************************************

F7G4L5_BCL2L2-02      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
F7G4L5_BCL2L2-03      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
F7G4L5_BCL2L2-05      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
F7G4L5_BCL2L2-04      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
                      **************************************************

F7G4L5_BCL2L2-02      agccatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
F7G4L5_BCL2L2-03      agccatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
F7G4L5_BCL2L2-05      agccatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
F7G4L5_BCL2L2-04      agccatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
                      **************************************************

F7G4L5_BCL2L2-02      tctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaa
F7G4L5_BCL2L2-03      tctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaa
F7G4L5_BCL2L2-05      tctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaa
F7G4L5_BCL2L2-04      tctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaa
                      **************************************************

F7G4L5_BCL2L2-02      cgcttcacccaggtctccgatgaacttttccaagggggccccaactgggg
F7G4L5_BCL2L2-03      cgcttcacccaggtctccgatgaacttttccaagggggccccaactgggg
F7G4L5_BCL2L2-05      cgcttcacccaggtctccgatgaacttttccaagggggccccaactgggg
F7G4L5_BCL2L2-04      cgcttcacccaggtctccgatgaacttttccaagggggccccaactgggg
                      **************************************************

F7G4L5_BCL2L2-02      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
F7G4L5_BCL2L2-03      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
F7G4L5_BCL2L2-05      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
F7G4L5_BCL2L2-04      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
                      **************************************************

F7G4L5_BCL2L2-02      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
F7G4L5_BCL2L2-03      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
F7G4L5_BCL2L2-05      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
F7G4L5_BCL2L2-04      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
                      **************************************************

F7G4L5_BCL2L2-02      gcctacctggagacgcggctggctgactggatccacagcagtgggggctg
F7G4L5_BCL2L2-03      gcctacctggagacgcggctggctgactggatccacagcagtgggggctg
F7G4L5_BCL2L2-05      gcctacctggagacgcggctggctgactggatccacagcagtgggggctg
F7G4L5_BCL2L2-04      gcctacctggagacgcggctggctgactggatccacagcagtgggggctg
                      **************************************************

F7G4L5_BCL2L2-02      ggc-----------------------------------------------
F7G4L5_BCL2L2-03      ggc-----------------------------------------------
F7G4L5_BCL2L2-05      --------------------------------------------------
F7G4L5_BCL2L2-04      gttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtg
                                                                        

F7G4L5_BCL2L2-02      ----------------------------------------------ggag
F7G4L5_BCL2L2-03      ----------------------------------------------ggag
F7G4L5_BCL2L2-05      ----------------------------------------------ggag
F7G4L5_BCL2L2-04      aaattttaagcgactgtgactctgctccaagttccccagatctcgaggag
                                                                    ****

F7G4L5_BCL2L2-02      t---------tcacagctctatacgggg----------------------
F7G4L5_BCL2L2-03      t---------tcacagctctatacgggg----------------------
F7G4L5_BCL2L2-05      ctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaa
F7G4L5_BCL2L2-04      ctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaa
                                *** ***** *  * ***                      

F7G4L5_BCL2L2-02      -----------------acgggg---------------------------
F7G4L5_BCL2L2-03      -----------------acgggg---------------------------
F7G4L5_BCL2L2-05      gctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccac
F7G4L5_BCL2L2-04      gctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccac
                                       *** **                           

F7G4L5_BCL2L2-02      ------------------------------ccctggaggaggcg-cggcg
F7G4L5_BCL2L2-03      ------------------------------ccctggaggaggcg-cggcg
F7G4L5_BCL2L2-05      ctccaggcaatgctggcccagtgatcatgtccattgaggagaagatggag
F7G4L5_BCL2L2-04      ctccaggcaatgctggcccagtgatcatgtccattgaggagaagatggag
                                                    ** * ******  *  ** *

F7G4L5_BCL2L2-02      tctg------------------------------------------cggg
F7G4L5_BCL2L2-03      tctg------------------------------------------cggg
F7G4L5_BCL2L2-05      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
F7G4L5_BCL2L2-04      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
                       ***                                          * * 

F7G4L5_BCL2L2-02      aggggaactgg---------------------------------------
F7G4L5_BCL2L2-03      aggggaactgg---------------------------------------
F7G4L5_BCL2L2-05      agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgtta
F7G4L5_BCL2L2-04      agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgtta
                      **  ** ****                                       

F7G4L5_BCL2L2-02      --------------------------------------------------
F7G4L5_BCL2L2-03      --------------------------------------------------
F7G4L5_BCL2L2-05      ccatactctgtgacaaatttagtggccatcctaaaggatttgcgtatata
F7G4L5_BCL2L2-04      ccatactctgtgacaaatttagtggccatcctaaaggatttgcgtatata
                                                                        

F7G4L5_BCL2L2-02      ---------------gcatcagtgaggac---------------------
F7G4L5_BCL2L2-03      ---------------gcatcagtgaggac---------------------
F7G4L5_BCL2L2-05      gagttctcagacaaagagtcagtgaggacttccttggccttagatgagtc
F7G4L5_BCL2L2-04      gagttctcagacaaagagtcagtgaggacttccttggccttagatgagtc
                                     *  ***********                     

F7G4L5_BCL2L2-02      ------------------------agtg----------------------
F7G4L5_BCL2L2-03      ------------------------agtg----------------------
F7G4L5_BCL2L2-05      cctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagac
F7G4L5_BCL2L2-04      cctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagac
                                               ***                      

F7G4L5_BCL2L2-02      ---------------ctgacggggg-------------------------
F7G4L5_BCL2L2-03      ---------------ctgacggggg-------------------------
F7G4L5_BCL2L2-05      caggcatcagcacaacagaccggggttttccacgagcccgctaccgcgcc
F7G4L5_BCL2L2-04      caggcatcagcacaacagaccggggttttccacgagcccgctaccgcgcc
                                     * *** ****                         

F7G4L5_BCL2L2-02      --------------------------------------ccgtggc----a
F7G4L5_BCL2L2-03      --------------------------------------ccgtggc----a
F7G4L5_BCL2L2-05      cggaccaccaactacaacagttcccgctctcgattctacagtggttttaa
F7G4L5_BCL2L2-04      cggaccaccaactacaacagttcccgctctcgattctacagtggttttaa
                                                            * ****     *

F7G4L5_BCL2L2-02      ctgggggccctg-----gtaactgtaggggcc------------------
F7G4L5_BCL2L2-03      ctgggggccctg-----gtaactgtaggggcc------------------
F7G4L5_BCL2L2-05      cagcaggccccggggtcgtgtctacaggggccgggctagagcgacatcat
F7G4L5_BCL2L2-04      cagcaggccccggggtcgtgtctacaggggccgggctagagcgacatcat
                      * *  ***** *     **  **  *******                  

F7G4L5_BCL2L2-02      --ttttttgctagcaagtga
F7G4L5_BCL2L2-03      --ttttttgctagcaagtga
F7G4L5_BCL2L2-05      ggtattccccttac---taa
F7G4L5_BCL2L2-04      ggtattccccttac---taa
                        * **   **  *   * *

© 1998-2018