Dataset for CDS BCL2L1 of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6UKR4_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
F6UKR4_BCL2L1-02      --------------------------------------------------
                                                                        

F6UKR4_BCL2L1-01      ttcccagaaaggatacagctggagtcaatttagtgatgtggaagagaaca
F6UKR4_BCL2L1-02      -----------------------------------atgtggaagagaaca
                                                         ***************

F6UKR4_BCL2L1-01      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
F6UKR4_BCL2L1-02      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
                      **************************************************

F6UKR4_BCL2L1-01      atcaatggcaacccatcctggcacctggtggacagccccgcggtgaatgg
F6UKR4_BCL2L1-02      atcaatggcaacccatcct-------------------------------
                      *******************                               

F6UKR4_BCL2L1-01      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
F6UKR4_BCL2L1-02      --------------------------------------------------
                                                                        

F6UKR4_BCL2L1-01      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
F6UKR4_BCL2L1-02      --------------------------------------------------
                                                                        

F6UKR4_BCL2L1-01      taccggcgggcgttcagtgacctgacatcccagctccacatcaccccagg
F6UKR4_BCL2L1-02      ------------------------------------------------gg
                                                                      **

F6UKR4_BCL2L1-01      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
F6UKR4_BCL2L1-02      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
                      **************************************************

F6UKR4_BCL2L1-01      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
F6UKR4_BCL2L1-02      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
                      **************************************************

F6UKR4_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
F6UKR4_BCL2L1-02      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                      **************************************************

F6UKR4_BCL2L1-01      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
F6UKR4_BCL2L1-02      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
                      **************************************************

F6UKR4_BCL2L1-01      agaacggcggctgggacacttttgtggaactctatgggaacaatgcagca
F6UKR4_BCL2L1-02      agaacggcggctgggacacttttgtggaactctatgggaacaatgcagca
                      **************************************************

F6UKR4_BCL2L1-01      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
F6UKR4_BCL2L1-02      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
                      **************************************************

F6UKR4_BCL2L1-01      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
F6UKR4_BCL2L1-02      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
                      **************************************************

F6UKR4_BCL2L1-01      ga
F6UKR4_BCL2L1-02      ga
                      **

© 1998-2019