Dataset for CDS BCL2A1 of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7E8V5_BCL2A1-02      atgacagactgtgaatttggatatatttacaggctagctcaggactattt
F7E8V5_BCL2A1-01      atgacagactgtgaatttggatatatttacaggctagctcaggactattt
                      **************************************************

F7E8V5_BCL2A1-02      gcagtacgttctgcagataccacaacctggatcgggtccaagcaaaacgt
F7E8V5_BCL2A1-01      gcagtacgttctgcagataccacaacctggatcgggtccaagcaaaacgt
                      **************************************************

F7E8V5_BCL2A1-02      ccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaag
F7E8V5_BCL2A1-01      ccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaag
                      **************************************************

F7E8V5_BCL2A1-02      aatctgaagccatgcttggacaatgttaatgttgcatccatagacactgc
F7E8V5_BCL2A1-01      aatctgaagccatgcttggacaatgttaatgttgcatccatagacactgc
                      **************************************************

F7E8V5_BCL2A1-02      cagaacactattcaatcaagtgatggaaaaggagtttgaagatggcatca
F7E8V5_BCL2A1-01      cagaacactattcaatcaagtgatggaaaaggagtttgaagatggcatca
                      **************************************************

F7E8V5_BCL2A1-02      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
F7E8V5_BCL2A1-01      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
                      **************************************************

F7E8V5_BCL2A1-02      aagaaacttctacgacagcgaattgccccggatgtggatacttataagga
F7E8V5_BCL2A1-01      aagaaacttctacgacagcgaattgccccggatgtggatacttataagga
                      **************************************************

F7E8V5_BCL2A1-02      gatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
F7E8V5_BCL2A1-01      gatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
                      **************************************************

F7E8V5_BCL2A1-02      taaggcaaaacggaggctgggggaa-------------------------
F7E8V5_BCL2A1-01      taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacct
                      *********************  **                         

F7E8V5_BCL2A1-02      ----atggcacaatcacatgccta-----tgctagtagagtcagtggccc
F7E8V5_BCL2A1-01      aaatctggctggatgacttttctagaagttacaggaaagatctgtgaaat
                           ****   ** ** *  ***     * *  * *   ** ***    

F7E8V5_BCL2A1-02      actag-----------------------
F7E8V5_BCL2A1-01      gctatctctcctgaagcaatactgttga
                       ***                        

© 1998-2018