Dataset for CDS MCL-1 of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I7G687_MCL1-01          atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K5W0W9_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgcgg
A0A2K5W0W9_MCL1-02      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgcgg
A0A2K5W0W9_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgcgg
                        *********************************************** **

I7G687_MCL1-01          gggggccggcttgggggccggcagcagcggcgccacccctccgggagggc
A0A2K5W0W9_MCL1-01      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K5W0W9_MCL1-02      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K5W0W9_MCL1-03      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
                        ************************* ************************

I7G687_MCL1-01          ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K5W0W9_MCL1-01      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K5W0W9_MCL1-02      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K5W0W9_MCL1-03      ggctttt-------------------------------------------
                        *******                                           

I7G687_MCL1-01          ggggaggccggcacggtgattggcggaagcgccggcgcaagccccccggc
A0A2K5W0W9_MCL1-01      ggggaggccggcacggtgattggcggaagcgccggcgcaagccccccggc
A0A2K5W0W9_MCL1-02      ggggaggccggcacggtgattggcggaagcgccggcgcaagccccccggc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
                                                                          

I7G687_MCL1-01          cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
A0A2K5W0W9_MCL1-01      cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
A0A2K5W0W9_MCL1-02      cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
                                                                          

I7G687_MCL1-01          cggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcg
A0A2K5W0W9_MCL1-01      cggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcg
A0A2K5W0W9_MCL1-02      cggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
                                                                          

I7G687_MCL1-01          cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
A0A2K5W0W9_MCL1-01      cccacccgccgcgcggggccgcttgaggagatggaagccccggccgccga
A0A2K5W0W9_MCL1-02      cccacccgccgcgcggggccgcttgaggagatggaagccccggccgccga
A0A2K5W0W9_MCL1-03      --------------------------------------------------
                                                                          

I7G687_MCL1-01          cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A2K5W0W9_MCL1-01      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A2K5W0W9_MCL1-02      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
                                                                          

I7G687_MCL1-01          tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A2K5W0W9_MCL1-01      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A2K5W0W9_MCL1-02      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A2K5W0W9_MCL1-03      --------------------------------------------------
                                                                          

I7G687_MCL1-01          ggtaatagccccagtacggatgggtcactaccctcgacgccgccgccagc
A0A2K5W0W9_MCL1-01      ggtaatagccccagtacggatgggtcactaccctcgacgccgccgccagc
A0A2K5W0W9_MCL1-02      ggtaatagccccagtacggatgggtcactaccctcgacgccgccgccagc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
                                                                          

I7G687_MCL1-01          agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
A0A2K5W0W9_MCL1-01      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
A0A2K5W0W9_MCL1-02      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
                                                                          

I7G687_MCL1-01          ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
A0A2K5W0W9_MCL1-01      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
A0A2K5W0W9_MCL1-02      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
A0A2K5W0W9_MCL1-03      ----------------ggccaccggcgccaaggacacaaagccaatgggc
                                        **********************************

I7G687_MCL1-01          aggtctggggccaccagcaggaaggctctggagaccttacgacgggttgg
A0A2K5W0W9_MCL1-01      aggtctggggccaccagcaggaaggctctggagaccttacgacgggttgg
A0A2K5W0W9_MCL1-02      aggtctggggccaccagcaggaaggctctggagaccttacgacgggttgg
A0A2K5W0W9_MCL1-03      aggtctggggccaccagcaggaaggctctggagaccttacgacgggttgg
                        **************************************************

I7G687_MCL1-01          ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A2K5W0W9_MCL1-01      ggatggcgtgcagcgcaaccacgagacggccttccaa-------------
A0A2K5W0W9_MCL1-02      ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A2K5W0W9_MCL1-03      ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
                        *************************************             

I7G687_MCL1-01          aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-02      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A2K5W0W9_MCL1-03      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
                                                                          

I7G687_MCL1-01          gtccatgtttttagcgacggcgtaacaaactggggcaggattgtgactct
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-02      gtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
A0A2K5W0W9_MCL1-03      gtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
                                                                          

I7G687_MCL1-01          catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaag
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-02      catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaag
A0A2K5W0W9_MCL1-03      catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaag
                                                                          

I7G687_MCL1-01          aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-02      aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5W0W9_MCL1-03      aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
                                                                          

I7G687_MCL1-01          acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
A0A2K5W0W9_MCL1-01      -----------------------------------ggatgggtttgtgga
A0A2K5W0W9_MCL1-02      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
A0A2K5W0W9_MCL1-03      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
                                                           ***************

I7G687_MCL1-01          gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A2K5W0W9_MCL1-01      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A2K5W0W9_MCL1-02      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A2K5W0W9_MCL1-03      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
                        **************************************************

I7G687_MCL1-01          cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A2K5W0W9_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A2K5W0W9_MCL1-02      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A2K5W0W9_MCL1-03      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
                        **************************************************

I7G687_MCL1-01          tag-----------
A0A2K5W0W9_MCL1-01      tagccttactgtaa
A0A2K5W0W9_MCL1-02      tag-----------
A0A2K5W0W9_MCL1-03      tag-----------
                        ***           

© 1998-2018