Dataset for CDS BCL-2-like of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5TKG9_BCL2L10      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-02      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------

A0A2K5TMD8_BCL2A1-      -----------------------------------atgacagactgtgaa
A0A2K5TMD8_BCL2A1-      -----------------------------------atgacagactgtgaa
A0A2K5UDI5_BCL2-01      -----------------------------------atggcgcacgctggg
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      -----------------------------------atgtggaa-------
A0A2K5VPG2_BCL2L1-      ttcccagaaaggatacagctggagtcaatttagtgatgtggaa-------
I7GKS6_BCL2L1-01        -----------------------------------atgtggaa-------
A0A2K5V0Q3_BCL2L2-      -----------------------------------atggcgacccc---a
A0A2K5V0Q3_BCL2L2-      -----------------------------------atggcgacccc---a
A0A2K5TKG9_BCL2L10      -----------------------------------atggctgaccc---g
I7G687_MCL1-01          -----------------------------------atgtttggcct----
A0A2K5W0W9_MCL1-01      -----------------------------------atgtttggcct----
A0A2K5W0W9_MCL1-02      -----------------------------------atgtttggcct----
A0A2K5W0W9_MCL1-03      -----------------------------------atgtttggcct----

A0A2K5TMD8_BCL2A1-      tttggatatatttacaggctagctcagg------actatttgcagtacgt
A0A2K5TMD8_BCL2A1-      tttggatatatttacaggctagctcagg------actatttgcagtacgt
A0A2K5UDI5_BCL2-01      agaacagggtacgataaccgggagatagtgatgaagtacatccactataa
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      ------------gagaacaggactgaggccccagaa--------------
A0A2K5VPG2_BCL2L1-      ------------gagaacaggactgaggccccagaa--------------
I7GKS6_BCL2L1-01        ------------gagaacaggactgaggccccagaa--------------
A0A2K5V0Q3_BCL2L2-      gcctcggccccagacacacgggctctggtggcagactttgtaggttataa
A0A2K5V0Q3_BCL2L2-      gcctcggccccagacacacgggctctggtggcagactttgtaggttataa
A0A2K5TKG9_BCL2L10      ttgcgggagcgcaccgagcgg-ctc--ctggccgac--------------
I7G687_MCL1-01          caaaagaaacgcggtaatcggactc--aacctctac--------------
A0A2K5W0W9_MCL1-01      caaaagaaacgcggtaatcggactc--aacctctac--------------
A0A2K5W0W9_MCL1-02      caaaagaaacgcggtaatcggactc--aacctctac--------------
A0A2K5W0W9_MCL1-03      caaaagaaacgcggtaatcggactc--aacctctac--------------

A0A2K5TMD8_BCL2A1-      tctgcagataccacaacctggatcgggtccaagcaaaacg----------
A0A2K5TMD8_BCL2A1-      tctgcagataccacaacctggatcgggtccaagcaaaacg----------
A0A2K5UDI5_BCL2-01      gctgtcgcagaggggctacgagtgggatgcgggggatgtgggcgcggcga
Q2PFS6_BCL2L1-01        --------------------------atggaga-----------------
A0A2K5VPG2_BCL2L1-      -----------gggactgaatcggagatggaga-----------------
A0A2K5VPG2_BCL2L1-      -----------gggactgaatcggagatggaga-----------------
I7GKS6_BCL2L1-01        -----------gggactgaatcggagatggaga-----------------
A0A2K5V0Q3_BCL2L2-      gctgaggcagaagggttatgtctgtggagctgg-----------------
A0A2K5V0Q3_BCL2L2-      gctgaggcagaagggttatgtctgtggagctgg-----------------
A0A2K5TKG9_BCL2L10      ------------------tatctggggtgctgc-----------------
I7G687_MCL1-01          ------------------tg-tgggggggccg------------------
A0A2K5W0W9_MCL1-01      ------------------tg-cgggggggccg------------------
A0A2K5W0W9_MCL1-02      ------------------tg-cgggggggccg------------------
A0A2K5W0W9_MCL1-03      ------------------tg-cgggggggccg------------------

A0A2K5TMD8_BCL2A1-      -tccagagtg----ctacaaaagg--------------------------
A0A2K5TMD8_BCL2A1-      -tccagagtg----ctacaaaagg--------------------------
A0A2K5UDI5_BCL2-01      cccctggggccgcccccgcaccgggcatcttctcctcccagcccgggcac
Q2PFS6_BCL2L1-01        -cccccagtg----ccatcaatgg--------------------------
A0A2K5VPG2_BCL2L1-      -cccccagtg----ccatcaatgg--------------------------
A0A2K5VPG2_BCL2L1-      -cccccagtg----ccatcaatgg--------------------------
I7GKS6_BCL2L1-01        -cccccagtg----ccatcaatgg--------------------------
A0A2K5V0Q3_BCL2L2-      -ccccggggagggcccagcagctg------------------------ac
A0A2K5V0Q3_BCL2L2-      -ccccggggagggcccagcagctg------------------------ac
A0A2K5TKG9_BCL2L10      -gcccgggaa----cc----------------------------------
I7G687_MCL1-01          -gcttggggg----ccggcagcag--------------------------
A0A2K5W0W9_MCL1-01      -gcttggggg----ccggcagcgg--------------------------
A0A2K5W0W9_MCL1-02      -gcttggggg----ccggcagcgg--------------------------
A0A2K5W0W9_MCL1-03      -gcttggggg----ccggcagcgg--------------------------
                          *    *      *                                   

A0A2K5TMD8_BCL2A1-      ttgcattctcagtccaa---------------------------------
A0A2K5TMD8_BCL2A1-      ttgcattctcagtccaa---------------------------------
A0A2K5UDI5_BCL2-01      acgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgct
Q2PFS6_BCL2L1-01        -----caacccatcctggcacctgg--------tggacagccccgcggtg
A0A2K5VPG2_BCL2L1-      -----caacccatcctgg--------------------------------
A0A2K5VPG2_BCL2L1-      -----caacccatcctggcacctgg--------tggacagccccgcggtg
I7GKS6_BCL2L1-01        -----caacccatcctgg--------------------------------
A0A2K5V0Q3_BCL2L2-      ccgctgcaccaagccatg--------------------------------
A0A2K5V0Q3_BCL2L2-      ccgctgcaccaagccatg--------------------------------
A0A2K5TKG9_BCL2L10      ---cggcacccctgagcc--------------------------------
I7G687_MCL1-01          cggcgccacccctccggg--------------------------------
A0A2K5W0W9_MCL1-01      cggcgccacccctccggg--------------------------------
A0A2K5W0W9_MCL1-02      cggcgccacccctccggg--------------------------------
A0A2K5W0W9_MCL1-03      cggcgccacccctccggg--------------------------------

A0A2K5TMD8_BCL2A1-      -------------------aaagaagt-----------ggaaaagaatct
A0A2K5TMD8_BCL2A1-      -------------------aaagaagt-----------ggaaaagaatct
A0A2K5UDI5_BCL2-01      gccgaccccggctgcccccgccgccgccgccgccgccgcggggcctgcgc
Q2PFS6_BCL2L1-01        aatggagccactggccacagcagcagtttggatgcccgggaggtgatccc
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      aatggagccactggccacagcagcagtttggatgcccgggaggtgatccc
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -------------------cgggcagct----------ggagatgagttc
A0A2K5V0Q3_BCL2L2-      -------------------cgggcagct----------ggagatgagttc
A0A2K5TKG9_BCL2L10      -------------------aaggccgtccac-------------------
I7G687_MCL1-01          -------------------agggcggcttttggctacggagaaggaggcc
A0A2K5W0W9_MCL1-01      -------------------agggcggcttttggctacggagaaggaggcc
A0A2K5W0W9_MCL1-02      -------------------agggcggcttttggctacggagaaggaggcc
A0A2K5W0W9_MCL1-03      -------------------agggcggctttt-------------------

A0A2K5TMD8_BCL2A1-      gaagccat------------------------------------------
A0A2K5TMD8_BCL2A1-      gaagccat------------------------------------------
A0A2K5UDI5_BCL2-01      tcagcccggtgccacct-gtggtccacctgaccctccgccaggccggtga
Q2PFS6_BCL2L1-01        catggcag-----------cagtaaagcaagcgctgagggaggcaggcga
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      catggcag-----------cagtaaagcaagcgctgagggaggcaggcga
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gagacccg------------------------------------------
A0A2K5V0Q3_BCL2L2-      gagacccg------------------------------------------
A0A2K5TKG9_BCL2L10      ---gcccg------------------------------------------
I7G687_MCL1-01          tcggcccggcgagagatagggggaggggaggccggcacggtgattggcgg
A0A2K5W0W9_MCL1-01      tcggcccggcgagagatagggggaggggaggccggcacggtgattggcgg
A0A2K5W0W9_MCL1-02      tcggcccggcgagagatagggggaggggaggccggcacggtgattggcgg
A0A2K5W0W9_MCL1-03      --------------------------------------------------

A0A2K5TMD8_BCL2A1-      ----------------------------------------gcttggacaa
A0A2K5TMD8_BCL2A1-      ----------------------------------------gcttggacaa
A0A2K5UDI5_BCL2-01      cgacttctcccgccgctaccgccgcgacttc---------gccgagatgt
Q2PFS6_BCL2L1-01        cgagtttgaactgcggtaccggcgggcgttc---------agtgacctga
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      cgagtttgaactgcggtaccggcgggcgttc---------agtgacctga
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ---------------cttccggcgcaccttc---------tctgatctgg
A0A2K5V0Q3_BCL2L2-      ---------------cttccggcgcaccttc---------tctgatctgg
A0A2K5TKG9_BCL2L10      ------------aggccgccgtgctgcgctc-------------------
I7G687_MCL1-01          aagcgccggcgcaagccccccggccgccctcacgccagacgcccggaggg
A0A2K5W0W9_MCL1-01      aagcgccggcgcaagccccccggccgccctcacgccagacgcccggaggg
A0A2K5W0W9_MCL1-02      aagcgccggcgcaagccccccggccgccctcacgccagacgcccggaggg
A0A2K5W0W9_MCL1-03      --------------------------------------------------

A0A2K5TMD8_BCL2A1-      tgttaatgttgc----------------------------atccatagac
A0A2K5TMD8_BCL2A1-      tgttaatgttgc----------------------------atccatagac
A0A2K5UDI5_BCL2-01      ccagccagctgc------------------------acctgacgcccttc
Q2PFS6_BCL2L1-01        catcccagctcc------------------------acatcaccccaggg
A0A2K5VPG2_BCL2L1-      -------------------------------------------------g
A0A2K5VPG2_BCL2L1-      catcccagctcc------------------------acatcaccccaggg
I7GKS6_BCL2L1-01        ----------------------------------------caccccaggg
A0A2K5V0Q3_BCL2L2-      cggctcagctgc------------------------atgtgaccccaggc
A0A2K5V0Q3_BCL2L2-      cggctcagctgc------------------------atgtgaccccaggc
A0A2K5TKG9_BCL2L10      ---cgcggccgcc-----------------------aggttacggcagct
I7G687_MCL1-01          tcgcgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagc
A0A2K5W0W9_MCL1-01      tcgcgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagc
A0A2K5W0W9_MCL1-02      tcgcgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagc
A0A2K5W0W9_MCL1-03      --------------------------------------------------

A0A2K5TMD8_BCL2A1-      act--------------------gccagaacactattcaatcaagtgatg
A0A2K5TMD8_BCL2A1-      act--------------------gccagaacactattcaatcaagtgatg
A0A2K5UDI5_BCL2-01      acc--------------------gcgcggggacgctttgccacggtggtg
Q2PFS6_BCL2L1-01        aca--------------------gcatatcagagctttgaacaagtagtg
A0A2K5VPG2_BCL2L1-      aca--------------------gcatatcagagctttgaacaggtagtg
A0A2K5VPG2_BCL2L1-      aca--------------------gcatatcagagctttgaacaggtagtg
I7GKS6_BCL2L1-01        aca--------------------gcatatcagagctttgaacaggtagtg
A0A2K5V0Q3_BCL2L2-      tca--------------------gcacagcaacgcttcacccaggtctcc
A0A2K5V0Q3_BCL2L2-      tca--------------------gcacagcaacgcttcacccaggtctcc
A0A2K5TKG9_BCL2L10      ccaccggtccttcttctc----cgcctaccgcggctaccccgggaaccgc
I7G687_MCL1-01          cccgcgaggctgcttttctttgcgcccac--ccgccgcgcggcgccgctt
A0A2K5W0W9_MCL1-01      cccgcgaggctgcttttctttgcgcccac--ccgccgcgcggggccgctt
A0A2K5W0W9_MCL1-02      cccgcgaggctgcttttctttgcgcccac--ccgccgcgcggggccgctt
A0A2K5W0W9_MCL1-03      --------------------------------------------------

A0A2K5TMD8_BCL2A1-      gaaaaggagtttgaagatggcatcattaactggggaagaatt--------
A0A2K5TMD8_BCL2A1-      gaaaaggagtttgaagatggcatcattaactggggaagaatt--------
A0A2K5UDI5_BCL2-01      gaggagctcttcagggacggggtg---aactgggggaggatc--------
Q2PFS6_BCL2L1-01        aatgaactcttccgggatggggta---aactggggtcgcatt--------
A0A2K5VPG2_BCL2L1-      aatgaactcttccgggatggggta---aactggggtcgcatt--------
A0A2K5VPG2_BCL2L1-      aatgaactcttccgggatggggta---aactggggtcgcatt--------
I7GKS6_BCL2L1-01        aatgaactcttccgggatggggta---aactggggtcgcatt--------
A0A2K5V0Q3_BCL2L2-      gatgaacttttccaagggggcccc---aactggggccgcctt--------
A0A2K5V0Q3_BCL2L2-      gatgaacttttccaagggggcccc---aactggggccgcctt--------
A0A2K5TKG9_BCL2L10      gtcgagct-------ggtggcgct---gatggcggaggccgt--------
I7G687_MCL1-01          gaggagat-------ggaagcccc---ggccgccgacgccatcatgtcgc
A0A2K5W0W9_MCL1-01      gaggagat-------ggaagcccc---ggccgccgacgccatcatgtcgc
A0A2K5W0W9_MCL1-02      gaggagat-------ggaagcccc---ggccgccgacgccatcatgtcgc
A0A2K5W0W9_MCL1-03      --------------------------------------------------

A0A2K5TMD8_BCL2A1-      ----------------------------------------gtaac-----
A0A2K5TMD8_BCL2A1-      ----------------------------------------gtaac-----
A0A2K5UDI5_BCL2-01      ----------------------------------------gtggc-----
Q2PFS6_BCL2L1-01        ----------------------------------------gtggc-----
A0A2K5VPG2_BCL2L1-      ----------------------------------------gtggc-----
A0A2K5VPG2_BCL2L1-      ----------------------------------------gtggc-----
I7GKS6_BCL2L1-01        ----------------------------------------gtggc-----
A0A2K5V0Q3_BCL2L2-      ----------------------------------------gtagc-----
A0A2K5V0Q3_BCL2L2-      ----------------------------------------gtagc-----
A0A2K5TKG9_BCL2L10      --------------------------------gctctccgacagc-----
I7G687_MCL1-01          ccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccg
A0A2K5W0W9_MCL1-01      ccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccg
A0A2K5W0W9_MCL1-02      ccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccg
A0A2K5W0W9_MCL1-03      --------------------------------------------------

A0A2K5TMD8_BCL2A1-      ----catatttgcatttgaaggtattct-------catcaagaaacttct
A0A2K5TMD8_BCL2A1-      ----catatttgcatttgaaggtattct-------catcaagaaacttct
A0A2K5UDI5_BCL2-01      ----cttctttgagttcggtggggtcatgtg----tgtggagagcgt---
Q2PFS6_BCL2L1-01        ----ctttttctccttcggcggggcactgtg----cgtggaaagcgt---
A0A2K5VPG2_BCL2L1-      ----ctttttctccttcggcggggcactgtg----cgtggaaagcgt---
A0A2K5VPG2_BCL2L1-      ----ctttttctccttcggcggggcactgtg----cgtggaaagcgt---
I7GKS6_BCL2L1-01        ----ctttttctccttcggcggggcactgtg----cgtggaaagcgt---
A0A2K5V0Q3_BCL2L2-      -cttctttgtct---ttggggctgcactgtg----tgctgagagtgt---
A0A2K5V0Q3_BCL2L2-      -cttctttgtct---ttggggctgcactgtg----tgctgagagtgt---
A0A2K5TKG9_BCL2L10      ----cccggccccacctggggcagggtggtgtcgctggtgaccttcg---
I7G687_MCL1-01          gctgtcctgcccctgctggagttggtcggggaatctggtaatagccc---
A0A2K5W0W9_MCL1-01      gctgtcctgcccctgctggagttggtcggggaatctggtaatagccc---
A0A2K5W0W9_MCL1-02      gctgtcctgcccctgctggagttggtcggggaatctggtaatagccc---
A0A2K5W0W9_MCL1-03      --------------------------------------------------

A0A2K5TMD8_BCL2A1-      acgacagcgaattgccccggatgtggatacttataaggagatttcgta--
A0A2K5TMD8_BCL2A1-      acgacagcgaattgccccggatgtggatacttataaggagatttcgta--
A0A2K5UDI5_BCL2-01      -caaccggga---------gatgtcgcccctggtggacaacatcgccc--
Q2PFS6_BCL2L1-01        -agacaagga---------gatgcaggtattggtgagtcggatcgcag--
A0A2K5VPG2_BCL2L1-      -agacaagga---------gatgcaggtattggtgagtcggatcgcag--
A0A2K5VPG2_BCL2L1-      -agacaagga---------gatgcaggtattggtgagtcggatcgcag--
I7GKS6_BCL2L1-01        -agacaagga---------gatgcaggtattggtgagtcggatcgcag--
A0A2K5V0Q3_BCL2L2-      -caacaagga---------gatggaaccactggtgggacaagtgcagg--
A0A2K5V0Q3_BCL2L2-      -caacaagga---------gatggaaccactggtgggacaagtgcagg--
A0A2K5TKG9_BCL2L10      -cg-----------------gggacgctgctggagagagagccgctggtg
I7G687_MCL1-01          -cagtacgga---------tgggtcactaccctcgacgccgccgccagca
A0A2K5W0W9_MCL1-01      -cagtacgga---------tgggtcactaccctcgacgccgccgccagca
A0A2K5W0W9_MCL1-02      -cagtacgga---------tgggtcactaccctcgacgccgccgccagca
A0A2K5W0W9_MCL1-03      --------------------------------------------------

A0A2K5TMD8_BCL2A1-      ----ttttgttgctgagttcataatgaataacacaggaga----------
A0A2K5TMD8_BCL2A1-      ----ttttgttgctgagttcataatgaataacacaggaga----------
A0A2K5UDI5_BCL2-01      -------tgtggatgactgagtacctgaaccggc------------acct
Q2PFS6_BCL2L1-01        -------cttggatggccacttacctgaa------------tgaccacct
A0A2K5VPG2_BCL2L1-      -------cttggatggccacttacctgaa------------tgaccacct
A0A2K5VPG2_BCL2L1-      -------cttggatggccacttacctgaa------------tgaccacct
I7GKS6_BCL2L1-01        -------cttggatggccacttacctgaa------------tgaccacct
A0A2K5V0Q3_BCL2L2-      -------agtggatggtggcctacctggagacgcgg----ctggctgact
A0A2K5V0Q3_BCL2L2-      -------agtggatggtggcctacctggagacgcgg----ctggctgact
A0A2K5TKG9_BCL2L10      acagcctggtggaagaagcggggcttccagccgcgg--------------
I7G687_MCL1-01          gaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcg
A0A2K5W0W9_MCL1-01      gaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcg
A0A2K5W0W9_MCL1-02      gaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcg
A0A2K5W0W9_MCL1-03      --------------------------------------------------

A0A2K5TMD8_BCL2A1-      ------atggataaggcaaaacggag------------------------
A0A2K5TMD8_BCL2A1-      ------atggataaggcaaaacggag------------------------
A0A2K5UDI5_BCL2-01      gcacacctggatccaggataacggag------------------------
Q2PFS6_BCL2L1-01        agagccttggatccaggagaacggcg------------------------
A0A2K5VPG2_BCL2L1-      agagccttggatccaggagaacggcg------------------------
A0A2K5VPG2_BCL2L1-      agagccttggatccaggagaacggcg------------------------
I7GKS6_BCL2L1-01        agagccttggatccaggagaacggcg------------------------
A0A2K5V0Q3_BCL2L2-      ggatccacagcagtgggggctgggcg----------gagttcacagctct
A0A2K5V0Q3_BCL2L2-      ggatccacagcagtgggggctgggagct----ggaagctatcaaagctcg
A0A2K5TKG9_BCL2L10      ----ctgaaggagcaggagggcgacgtc----------------------
I7G687_MCL1-01          gtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggca
A0A2K5W0W9_MCL1-01      gtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggca
A0A2K5W0W9_MCL1-02      gtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggca
A0A2K5W0W9_MCL1-03      ---------------ggccaccggcgccaaggacacaaagccaatgggca
                                       *      *  *                        

A0A2K5TMD8_BCL2A1-      --gct-gg------------------------------------------
A0A2K5TMD8_BCL2A1-      --gctggg------------------------------------------
A0A2K5UDI5_BCL2-01      --gctggg-------acgcctttgtggaactgtacggccccagcat-gcg
Q2PFS6_BCL2L1-01        --gctggg-------acacttttgtggaactctatgggaacaatgcagca
A0A2K5VPG2_BCL2L1-      --gctggg-------acacttttgtggaactctatgggaacaatgcagca
A0A2K5VPG2_BCL2L1-      --gctggg-------acacttttgtggaactctatgggaacaatgcagca
I7GKS6_BCL2L1-01        --gctggg-------acacttttgtggaactctatgggaacaatgcagca
A0A2K5V0Q3_BCL2L2-      atacgggg---------------------------------------acg
A0A2K5V0Q3_BCL2L2-      agtcagggagatggaggaagaagctgagaagctaaaggagctacagaacg
A0A2K5TKG9_BCL2L10      -gcccggg-------actgccagcg-------cctggtggccttgc--tg
I7G687_MCL1-01          ggtctggg-------gccaccagcaggaaggctctggagaccttacgacg
A0A2K5W0W9_MCL1-01      ggtctggg-------gccaccagcaggaaggctctggagaccttacgacg
A0A2K5W0W9_MCL1-02      ggtctggg-------gccaccagcaggaaggctctggagaccttacgacg
A0A2K5W0W9_MCL1-03      ggtctggg-------gccaccagcaggaaggctctggagaccttacgacg
                           *  **                                          

A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      gcctctgtttg---------------------------------------
Q2PFS6_BCL2L1-01        gccgagagccg---------------------------------------
A0A2K5VPG2_BCL2L1-      gccgagagccg---------------------------------------
A0A2K5VPG2_BCL2L1-      gccgagagccg---------------------------------------
I7GKS6_BCL2L1-01        gccgagagccg---------------------------------------
A0A2K5V0Q3_BCL2L2-      ggg-----------------------------------------------
A0A2K5V0Q3_BCL2L2-      aggtagagaagcagatgaatatgagtccacctccaggcaatgctggccca
A0A2K5TKG9_BCL2L10      agctcg---cg---------------------------------------
I7G687_MCL1-01          ggttggggatg---------------------------------------
A0A2K5W0W9_MCL1-01      ggttggggatg---------------------------------------
A0A2K5W0W9_MCL1-02      ggttggggatg---------------------------------------
A0A2K5W0W9_MCL1-03      ggttggggatg---------------------------------------

A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ----------ccctggaggaggcg-cggcgtctg----------------
A0A2K5V0Q3_BCL2L2-      gtgatcatgtccattgaggagaagatggaggctgatgcc-----------
A0A2K5TKG9_BCL2L10      ----------gctcgcggggcagcaccgcgcctggcttc-----------
I7G687_MCL1-01          ----------gcgtgcagcgcaaccacgagacggccttccaaggcatgct
A0A2K5W0W9_MCL1-01      ----------gcgtgcagcgcaaccacgagacggccttccaa--------
A0A2K5W0W9_MCL1-02      ----------gcgtgcagcgcaaccacgagacggccttccaaggcatgct
A0A2K5W0W9_MCL1-03      ----------gcgtgcagcgcaaccacgagacggccttccaaggcatgct

A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ------------------------------------------cgttccat
A0A2K5TKG9_BCL2L10      --------------------------------------------------
I7G687_MCL1-01          tcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgag
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-02      tcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgag
A0A2K5W0W9_MCL1-03      tcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgag

A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -----------------------------cgggaggggaactgg------
A0A2K5V0Q3_BCL2L2-      ctatgttggcaatgtggactatggtgcaacagcagaagagctggaagctc
A0A2K5TKG9_BCL2L10      --------------------------------------------------
I7G687_MCL1-01          tgatggtccatgtttttagcgacggcgtaacaaactggggcaggattgtg
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-02      tgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtg
A0A2K5W0W9_MCL1-03      tgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtg

A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      actttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaa
A0A2K5TKG9_BCL2L10      --------------------------------------------------
I7G687_MCL1-01          actctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaa
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-02      actctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaa
A0A2K5W0W9_MCL1-03      actctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaa

A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      tttagtggcca-----------------------------------tccc
A0A2K5TKG9_BCL2L10      ------aggct---------------------------------------
I7G687_MCL1-01          ccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcg
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-02      ccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcg
A0A2K5W0W9_MCL1-03      ccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcg

A0A2K5TMD8_BCL2A1-      --------------------------------------gaaaatggcttt
A0A2K5TMD8_BCL2A1-      --------------------------------------ggaaatggc---
A0A2K5UDI5_BCL2-01      ----------------------atttctcctggctgtctctgaagactct
Q2PFS6_BCL2L1-01        -------------------------------aaagggccaggagcgcttc
A0A2K5VPG2_BCL2L1-      -------------------------------aaagggccaggagcgcttc
A0A2K5VPG2_BCL2L1-      -------------------------------aaagggccaggagcgcttc
I7GKS6_BCL2L1-01        -------------------------------aaagggccaggagcgcttc
A0A2K5V0Q3_BCL2L2-      ---------------------------------gcatcagtgaggac---
A0A2K5V0Q3_BCL2L2-      aaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttc
A0A2K5TKG9_BCL2L10      -----------------------------cagggcggctgggatggcttt
I7G687_MCL1-01          taaggacaaaacgggactggctagttaaacaaagaggctgggatgggttt
A0A2K5W0W9_MCL1-01      ----------------------------------------ggatgggttt
A0A2K5W0W9_MCL1-02      taaggacaaaacgggactggctagttaaacaaagaggctgggatgggttt
A0A2K5W0W9_MCL1-03      taaggacaaaacgggactggctagttaaacaaagaggctgggatgggttt

A0A2K5TMD8_BCL2A1-      gtaa--------------------------------------agaagttt
A0A2K5TMD8_BCL2A1-      ------------------------------------------acaatcac
A0A2K5UDI5_BCL2-01      gctc--------------------------------------agtttggc
Q2PFS6_BCL2L1-01        aacc--------------------------------------gctggttc
A0A2K5VPG2_BCL2L1-      aacc--------------------------------------gctggttc
A0A2K5VPG2_BCL2L1-      aacc--------------------------------------gctggttc
I7GKS6_BCL2L1-01        aacc--------------------------------------gctggttc
A0A2K5V0Q3_BCL2L2-      ------------------------------------------agtg----
A0A2K5V0Q3_BCL2L2-      cttggccttagatgagtccctatttagaggaaggcaaatcaaggtgatcc
A0A2K5TKG9_BCL2L10      tgtc--------------------------------------acttcttc
I7G687_MCL1-01          gtgg--------------------------------------agttcttc
A0A2K5W0W9_MCL1-01      gtgg--------------------------------------agttcttc
A0A2K5W0W9_MCL1-02      gtgg--------------------------------------agttcttc
A0A2K5W0W9_MCL1-03      gtgg--------------------------------------agttcttc

A0A2K5TMD8_BCL2A1-      gaacctaaat-----------------------ctggctgga--------
A0A2K5TMD8_BCL2A1-      atgcctatg------------------------ctagtagag--------
A0A2K5UDI5_BCL2-01      c--------------------------------ctggtgggagc------
Q2PFS6_BCL2L1-01        ---------------------------------ctgacgggca-------
A0A2K5VPG2_BCL2L1-      ---------------------------------ctgacgggca-------
A0A2K5VPG2_BCL2L1-      ---------------------------------ctgacgggca-------
I7GKS6_BCL2L1-01        ---------------------------------ctgacgggca-------
A0A2K5V0Q3_BCL2L2-      ---------------------------------ctgacggggg-------
A0A2K5V0Q3_BCL2L2-      caaaacgaaccaacagaccaggcatcagcacaacagaccggggttttcca
A0A2K5TKG9_BCL2L10      a----ggagccc---------------------ctttccgctggcttttt
I7G687_MCL1-01          catgtagaggac---------------------ctagaaggtggcatc--
A0A2K5W0W9_MCL1-01      catgtagaggac---------------------ctagaaggtggcatc--
A0A2K5W0W9_MCL1-02      catgtagaggac---------------------ctagaaggtggcatc--
A0A2K5W0W9_MCL1-03      catgtagaggac---------------------ctagaaggtggcatc--
                                                         *     *          

A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5TMD8_BCL2A1-      --------------------------------------------------
A0A2K5UDI5_BCL2-01      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      cgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcg
A0A2K5TKG9_BCL2L10      ggagaaaactgctgatc---------------------------------
I7G687_MCL1-01          --agaaatgtgctg--c---------------------------------
A0A2K5W0W9_MCL1-01      --agaaatgtgctg--c---------------------------------
A0A2K5W0W9_MCL1-02      --agaaatgtgctg--c---------------------------------
A0A2K5W0W9_MCL1-03      --agaaatgtgctg--c---------------------------------

A0A2K5TMD8_BCL2A1-      ---------tgacttttctagaagttacaggaaagatctgtgaaatgcta
A0A2K5TMD8_BCL2A1-      ---------tcagtggcccacaag---aagaaaatggctttgtaa-----
A0A2K5UDI5_BCL2-01      ---------ttgcatcaccctgggtgcctatctgggccacaag-------
Q2PFS6_BCL2L1-01        ---------tgactgtggccggcgtggttctgctgggctca--------c
A0A2K5VPG2_BCL2L1-      ---------tgactgtggccggcgtggttctgctgggctca--------c
A0A2K5VPG2_BCL2L1-      ---------tgactgtggccggcgtggttctgctgggctca--------c
I7GKS6_BCL2L1-01        ---------tgactgtggccggcgtggttctgctgggctca--------c
A0A2K5V0Q3_BCL2L2-      ------ccgtggc----actgggggccctg-----gtaactgtaggggcc
A0A2K5V0Q3_BCL2L2-      attctacagtggttttaacagcaggccccggggtcgtgtctacaggggcc
A0A2K5TKG9_BCL2L10      ---------caggctttcctggcatgcttg--ttagcaacagccttcggt
I7G687_MCL1-01          ---------tggcttttgcaggtgttgctggagtaggagctggtttggca
A0A2K5W0W9_MCL1-01      ---------tggcttttgcaggtgttgctggagtaggagctggtttggca
A0A2K5W0W9_MCL1-02      ---------tggcttttgcaggtgttgctggagtaggagctggtttggca
A0A2K5W0W9_MCL1-03      ---------tggcttttgcaggtgttgctggagtaggagctggtttggca

A0A2K5TMD8_BCL2A1-      tctctcctgaagcaatactgt--------------tga
A0A2K5TMD8_BCL2A1-      --------------------------------------
A0A2K5UDI5_BCL2-01      -----------------------------------tga
Q2PFS6_BCL2L1-01        tcttcagtcggaaa---------------------tga
A0A2K5VPG2_BCL2L1-      tcttcagtcggaaa---------------------tga
A0A2K5VPG2_BCL2L1-      tcttcagtcggaaa---------------------tga
I7GKS6_BCL2L1-01        tcttcagtcggaaa---------------------tga
A0A2K5V0Q3_BCL2L2-      --------------------ttttttgctagcaagtga
A0A2K5V0Q3_BCL2L2-      gggctagagcgacatcatggtattccccttac---taa
A0A2K5TKG9_BCL2L10      tatct--ctggacacgattatta------------tga
I7G687_MCL1-01          tatctaataagatag-----------------------
A0A2K5W0W9_MCL1-01      tatctaataagatagccttactg------------taa
A0A2K5W0W9_MCL1-02      tatctaataagatag-----------------------
A0A2K5W0W9_MCL1-03      tatctaataagatag-----------------------

© 1998-2019