Dataset for CDS BCL2L1 of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
I7GKS6_BCL2L1-01        --------------------------------------------------

Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5VPG2_BCL2L1-      -----------------------------------atgtggaagagaaca
A0A2K5VPG2_BCL2L1-      ttcccagaaaggatacagctggagtcaatttagtgatgtggaagagaaca
I7GKS6_BCL2L1-01        -----------------------------------atgtggaagagaaca

Q2PFS6_BCL2L1-01        --------------------------------atggagacccccagtgcc
A0A2K5VPG2_BCL2L1-      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
A0A2K5VPG2_BCL2L1-      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
I7GKS6_BCL2L1-01        ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc

Q2PFS6_BCL2L1-01        atcaatggcaacccatcctggcacctggtggacagccccgcggtgaatgg
A0A2K5VPG2_BCL2L1-      atcaatggcaacccatcctgg-----------------------------
A0A2K5VPG2_BCL2L1-      atcaatggcaacccatcctggcacctggtggacagccccgcggtgaatgg
I7GKS6_BCL2L1-01        atcaatggcaacccatcctgg-----------------------------

Q2PFS6_BCL2L1-01        agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
I7GKS6_BCL2L1-01        --------------------------------------------------

Q2PFS6_BCL2L1-01        cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
I7GKS6_BCL2L1-01        --------------------------------------------------

Q2PFS6_BCL2L1-01        taccggcgggcgttcagtgacctgacatcccagctccacatcaccccagg
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      taccggcgggcgttcagtgacctgacatcccagctccacatcaccccagg
I7GKS6_BCL2L1-01        -----------------------------------------caccccagg

Q2PFS6_BCL2L1-01        gacagcatatcagagctttgaacaagtagtgaatgaactcttccgggatg
A0A2K5VPG2_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
A0A2K5VPG2_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
I7GKS6_BCL2L1-01        gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
                        ************************ *************************

Q2PFS6_BCL2L1-01        gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
A0A2K5VPG2_BCL2L1-      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
A0A2K5VPG2_BCL2L1-      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
I7GKS6_BCL2L1-01        gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg

Q2PFS6_BCL2L1-01        tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A2K5VPG2_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A2K5VPG2_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
I7GKS6_BCL2L1-01        tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc

Q2PFS6_BCL2L1-01        agcttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A2K5VPG2_BCL2L1-      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A2K5VPG2_BCL2L1-      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
I7GKS6_BCL2L1-01        agcttggatggccacttacctgaatgaccacctagagccttggatccagg

Q2PFS6_BCL2L1-01        agaacggcggctgggacacttttgtggaactctatgggaacaatgcagca
A0A2K5VPG2_BCL2L1-      agaacggcggctgggacacttttgtggaactctatgggaacaatgcagca
A0A2K5VPG2_BCL2L1-      agaacggcggctgggacacttttgtggaactctatgggaacaatgcagca
I7GKS6_BCL2L1-01        agaacggcggctgggacacttttgtggaactctatgggaacaatgcagca

Q2PFS6_BCL2L1-01        gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
A0A2K5VPG2_BCL2L1-      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
A0A2K5VPG2_BCL2L1-      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
I7GKS6_BCL2L1-01        gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg

Q2PFS6_BCL2L1-01        catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
A0A2K5VPG2_BCL2L1-      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
A0A2K5VPG2_BCL2L1-      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
I7GKS6_BCL2L1-01        catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat

Q2PFS6_BCL2L1-01        ga
A0A2K5VPG2_BCL2L1-      ga
A0A2K5VPG2_BCL2L1-      ga
I7GKS6_BCL2L1-01        ga

© 1998-2019