Dataset for CDS BCL-2-like of organism Loxodonta africana

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3T8E6_BCL2A1-01      -------atg----------------------------------------
G3SPN0_BCL2L1-01      -------atgt---------------------------------------
G3ULB7_BCL2-02        -------at-----------------------------------------
G3ULB7_BCL2-01        -------at-----------------------------------------
G3T756_MCL1-01        -------atgttcggcttcaagagaaacgcagtaatcggactcaaccttt
G3TMU7_BCL2L2-01      tatattcatgttagtctt-----------------------tcatccctg

G3T8E6_BCL2A1-01      ------------------------------------------actgactg
G3SPN0_BCL2L1-01      -------------------------------------ctcagagcaaccg
G3ULB7_BCL2-02        ---------ggcgcacgcagggaga--------acaggttatgacaaccg
G3ULB7_BCL2-01        ---------ggcgcacgcagggaga--------acaggttatgacaaccg
G3T756_MCL1-01        act-gtgggggggccggcttggggg--ccggcggctgcgccacccctccg
G3TMU7_BCL2L2-01      actcttgcagccgcccgcatggcgaccccagcctcagccccagacacacg

G3T8E6_BCL2A1-01      tgagtt--tggatacattt--------------------acaagctggtc
G3SPN0_BCL2L1-01      ggagctggtggttgacttt-------------ctctcctacaagctttcc
G3ULB7_BCL2-02        ggagatagtgatgaagtat-------------atccactataagctgtcg
G3ULB7_BCL2-01        ggagatagtgatgaagtat-------------atccactataagctgtcg
G3T756_MCL1-01        gga------gggcgacttccagctcctggaaaggaggccacggccc--gg
G3TMU7_BCL2L2-01      ggctctggtggcagacttt-------------gtgggctacaagctgagg
                       *       *      *                      *    *     

G3T8E6_BCL2A1-01      cagga-------------------------ctatctgaag----------
G3SPN0_BCL2L1-01      cagaaaggatacagttggagtcagtttagtgatgtggaggagaataggac
G3ULB7_BCL2-02        cagcggggctacgaatgg------------gaggctggcgaagct-----
G3ULB7_BCL2-01        cagcggggctacgaatgg------------gaggctggcgaagctagcgc
G3T756_MCL1-01        caagag------gtaggg------------ggaggggacg----------
G3TMU7_BCL2L2-01      cagaagggttatgtttgt------------ggagctggcc----------
                      **                                  *             

G3T8E6_BCL2A1-01      --------------------------------------------------
G3SPN0_BCL2L1-01      tggggcctcggaaggcactgaatccgagatggagatccccagtgccatca
G3ULB7_BCL2-02        --------------------------------------------------
G3ULB7_BCL2-01        cgcgccccccggggccgctcccgcgccgggcgtcctctcttctccgcccg
G3T756_MCL1-01        --------------------------------------------------
G3TMU7_BCL2L2-01      --------------------------------------------------

G3T8E6_BCL2A1-01      -----------------tacgtcctgcagataccacaac-----------
G3SPN0_BCL2L1-01      atggcaacccatccc--ggcacctggcagacagccctgcggtgaatggag
G3ULB7_BCL2-02        -----------------gacaccaggacctcgccgctccag---------
G3ULB7_BCL2-01        cggcgccccggggcccggacaccaggacctcgccgctccag---------
G3T756_MCL1-01        --------ccggcgcgagccccccggccgctgtcgctccgg---------
G3TMU7_BCL2L2-01      --------ccggggaggg---cccagcagctgacccgctgc---------
                                            *  *       * *              

G3T8E6_BCL2A1-01      -------------ctgcagctggttcaagcaa--aacgtccagagtgtta
G3SPN0_BCL2L1-01      ctactggccacagcagcagcttggatgcccgggaggtgatccccatgg--
G3ULB7_BCL2-02        ------------gctgac--ccggccgcgcagccggcgctcagcccggtg
G3ULB7_BCL2-01        ------------gctgac--ccggccgcgcagccggcgctcagcccggtg
G3T756_MCL1-01        ------------acggccggagggtcgtgcggccggcgccca--------
G3TMU7_BCL2L2-01      ------------ac------caagccatgcgggcagc-------------
                                   *               *                    

G3T8E6_BCL2A1-01      caaaatgtggctttctcagttcaaaaagaagttgaaaagaa----tttga
G3SPN0_BCL2L1-01      ----cagcagtgaagcaagctctgagggaggcaggcgatgag---ttcga
G3ULB7_BCL2-02        ccacctgtagttcacctgaccttgcgccaggccggcgacgacttctccag
G3ULB7_BCL2-01        ccacctgtagttcacctgaccttgcgccaggccggcgacgacttctccag
G3T756_MCL1-01        -------------------------------ttggcgccgagggccccga
G3TMU7_BCL2L2-01      --------------------------------tggagatgag---ttcga
                                                       *      *         

G3T8E6_BCL2A1-01      aa------ccctgcttggac-----aattttgttg----------tcatc
G3SPN0_BCL2L1-01      a----ctgcggtaccggcgg-----gcattcagtgacctgacatcccagc
G3ULB7_BCL2-02        g-------cgctaccgccgc-----gacttcgccgagatgtcgagccagc
G3ULB7_BCL2-01        g-------cgctaccgccgc-----gacttcgccgagatgtcgagccagc
G3T756_MCL1-01        cgtcactgcgattcccgcgaggccgacgttctttgc----gcccacccgc
G3TMU7_BCL2L2-01      gacc----cgcttccggcgc-----accttctctgatctggcagcccagc
                              *  * *              **    *           *  *

G3T8E6_BCL2A1-01      tccat--------------------tgataccgcccaaacaatat-tcaa
G3SPN0_BCL2L1-01      tccacatcacccc------------agggacagcatatcagagct-ttga
G3ULB7_BCL2-02        tgcacctgactccctt------------caccgcgaggggacgct-ttgc
G3ULB7_BCL2-01        tgcacctgactccctt------------caccgcgaggggacgct-ttgc
G3T756_MCL1-01        cgcgcgtcgccgcctgtggagatggaggctctagccgccgacgccatcat
G3TMU7_BCL2L2-01      tgcatgtgacccc------------aggctcagcccagcaacgct-tcac
                        *                           *               *   

G3T8E6_BCL2A1-01      gcaagtgatggaaaaggaatttgaagatggcatcattaactggggaagaa
G3SPN0_BCL2L1-01      gcaggtagtgaacgaactcttccgggatggggtg---aactggggtcgca
G3ULB7_BCL2-02        cacggtggtggaggagctcttcagggacggggtg---aactgggggcgga
G3ULB7_BCL2-01        cacggtggtggaggagctcttcagggacggggtg---aactgggggcgga
G3T756_MCL1-01        gtcgcccgaagaggagct-----ggacgggtacg---agccggagccgct
G3TMU7_BCL2L2-01      ccaggtctctgatgaactcttccaagggggcccc---aactggggccgcc
                                 *  *             **       * * ** *  *  

G3T8E6_BCL2A1-01      ttg--------tgaccatatttgcat--ttggaggtattct---catcaa
G3SPN0_BCL2L1-01      ttg--------tggcctttttctcct--tcggtggggcactgtgcgtgga
G3ULB7_BCL2-02        ttg--------tggccttctttgagt--tcggtggggtcatgtgtgtgga
G3ULB7_BCL2-01        ttg--------tggccttctttgagt--tcggtggggtcatgtgtgtgga
G3T756_MCL1-01        cgggaagcggccggctgtttttccccggctggggctggtcggggaggcca
G3TMU7_BCL2L2-01      ttg--------tggccttctttgtct--ttggggctgctctgtgtgctga
                        *         * *  * **         ** *               *

G3T8E6_BCL2A1-01      gaaacttctaagggagcgaattg------ccccagatgtggatacttaca
G3SPN0_BCL2L1-01      a----------agcgtagacaag---------gagatgcaggtattggtg
G3ULB7_BCL2-02        g----------agcgtcaaccgg---------gagatgtcgcccctggtg
G3ULB7_BCL2-01        g----------agcgtcaaccgg---------gagatgtcgcccctggtg
G3T756_MCL1-01        gtaatggccccggtaccgacgggtcactaccctcgacgccgcccctagca
G3TMU7_BCL2L2-01      g----------agtgtcaacaag---------gagatggagccactggtg
                                  *     *   *           ** *  *    *    

G3T8E6_BCL2A1-01      agaagatttcttcttttgttg-ctgag-----------------------
G3SPN0_BCL2L1-01      agtcggatcgcaacttggatggctact-----------------------
G3ULB7_BCL2-02        gacaacatcgccctctggatgactgag-----------------------
G3ULB7_BCL2-01        gacaacatcgccctctggatgactgag-----------------------
G3T756_MCL1-01        gaggaggaggaggacgagttgtaccggcagtcgctagagattatctctcg
G3TMU7_BCL2L2-01      ggacaagtgcaggagtggat-----ggtggtc------------------
                                       * *                              

G3T8E6_BCL2A1-01      -ttcatagtggataacacagcagagt----ggat-aaggcaaaacgga--
G3SPN0_BCL2L1-01      -tacctgaatgaccacctagagcctt----ggat-ccaggagaacggc--
G3ULB7_BCL2-02        -tacctgaaccggcacctgcacacct----ggat-ccaggataacgga--
G3ULB7_BCL2-01        -tacctgaaccggcacctgcacacct----ggat-ccaggataacgga--
G3T756_MCL1-01        gtaccttcaggagcaggcaaccggcgccaaggacaccaagccaatgggcg
G3TMU7_BCL2L2-01      -tacctggagacgcggctggctgact----ggat-ccacagcagtggg--
                       * * *                        ***         *  **   

G3T8E6_BCL2A1-01      --------------ggctgggaaa-----atggctttgtgaagaagtttg
G3SPN0_BCL2L1-01      --------------ggctgggtaaggaccacgccccttttgtgcttca--
G3ULB7_BCL2-02        --------------ggatgggtag-------------------gtgcatg
G3ULB7_BCL2-01        --------------ggatgg---g-------------------atgcctt
G3T756_MCL1-01        ggtctggggcggccagcaggaaggcgttagagaccctccggcgagtcgcg
G3TMU7_BCL2L2-01      --------------ggctgggcggagttcacagctct------atacggg
                                     *  **                              

G3T8E6_BCL2A1-01      aacctaggtctggctggc-------tgactttt-----------------
G3SPN0_BCL2L1-01      ----gtacctcagtgaaggaagacatagcctatg----------------
G3ULB7_BCL2-02        tgtgg---------------------------------------------
G3ULB7_BCL2-01        tgtggaactgtatggccccaacatgcgacctctgtttgatttctc-----
G3T756_MCL1-01        gacggggtgcagcgcaaccacgagacggccttccaaggaatgcttcggaa
G3TMU7_BCL2L2-01      gacggggccctggagga----ggcacggcgtctgcgggag------ggga

G3T8E6_BCL2A1-01      -ctggaagttacaggaaagatttgtga-----------------------
G3SPN0_BCL2L1-01      --tgttcattcaggtcaaaacctatgc-----------------------
G3ULB7_BCL2-02        --------------ttgaa-------------------------------
G3ULB7_BCL2-01        -ctggctgtc---tctgaagacactgc-----------------------
G3T756_MCL1-01        actggacatcaaaaacgaagatgatgtcaaatctttatctcgagtaatgg
G3TMU7_BCL2L2-01      actgggcatc---agtgaggacagtgc-----------------------

G3T8E6_BCL2A1-01      --------------------------------------------aatgtt
G3SPN0_BCL2L1-01      -------------------------aagtgggaagttagtccagtgtttc
G3ULB7_BCL2-02        --------------------------------------------------
G3ULB7_BCL2-01        ------------------------tcagtctggccctggtgggagcttgc
G3T756_MCL1-01        cccatgttttcagtgacgggataacaaactggggcagaattgtgactctc
G3TMU7_BCL2L2-01      -------------tgacggg------ggctgtggc--actgggggccctg

G3T8E6_BCL2A1-01      atttctcctgaagcaatactattga-------------------------
G3SPN0_BCL2L1-01      ctcaccct----gacacaatggttcaccacccaa----------------
G3ULB7_BCL2-02        --------------------------------------------------
G3ULB7_BCL2-01        atcaccctgggtgcttacctgg----------------------------
G3T756_MCL1-01        atatcttttggtgcctttgtggccaaacacttgaagagcgtaaaccaaga
G3TMU7_BCL2L2-01      gtaactgtaggggccttt--------------------------------

G3T8E6_BCL2A1-01      --------------------------------------------------
G3SPN0_BCL2L1-01      --------------------------------------------------
G3ULB7_BCL2-02        --------------------------------------------------
G3ULB7_BCL2-01        --------------------------------------------------
G3T756_MCL1-01        aagccgcatcgaaccattagcagaaagtatcacagatgttctcgtaagga
G3TMU7_BCL2L2-01      --------------------------------------------------

G3T8E6_BCL2A1-01      --------------------------------------------------
G3SPN0_BCL2L1-01      --------------------------------------------------
G3ULB7_BCL2-02        --------------------------------------------------
G3ULB7_BCL2-01        --------------------------------------------------
G3T756_MCL1-01        cgaaaagggactggttagtcaaacaaagaggctgggatgggtttgtggag
G3TMU7_BCL2L2-01      -----------------------------------------tttg-----

G3T8E6_BCL2A1-01      --------------------------------------------------
G3SPN0_BCL2L1-01      --------------------------------------------------
G3ULB7_BCL2-02        --------------------------------------------------
G3ULB7_BCL2-01        ------------------ggcacaagtga---------------------
G3T756_MCL1-01        ttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggc
G3TMU7_BCL2L2-01      ------------------ctagcaagtga---------------------

G3T8E6_BCL2A1-01      --------------------------------------------------
G3SPN0_BCL2L1-01      --------------------------------------------------
G3ULB7_BCL2-02        --------------------------------------------------
G3ULB7_BCL2-01        --------------------------------------------------
G3T756_MCL1-01        ttttgcaggtgttgctggagtaggagctggtttggcatatctaataagat
G3TMU7_BCL2L2-01      --------------------------------------------------

G3T8E6_BCL2A1-01      --
G3SPN0_BCL2L1-01      --
G3ULB7_BCL2-02        --
G3ULB7_BCL2-01        --
G3T756_MCL1-01        ag
G3TMU7_BCL2L2-01      --

© 1998-2019