Dataset for CDS BCL-2 of organism Loxodonta africana

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3ULB7_BCL2-02      atggcgcacgcagggagaacaggttatgacaaccgggagatagtgatgaagtatatccac
G3ULB7_BCL2-01      atggcgcacgcagggagaacaggttatgacaaccgggagatagtgatgaagtatatccac
                    ************************************************************

G3ULB7_BCL2-02      tataagctgtcgcagcggggctacgaatgggaggctggcgaagct---------------
G3ULB7_BCL2-01      tataagctgtcgcagcggggctacgaatgggaggctggcgaagctagcgccgcgcccccc
                    *********************************************               

G3ULB7_BCL2-02      ---------------------------------------------------------gac
G3ULB7_BCL2-01      ggggccgctcccgcgccgggcgtcctctcttctccgcccgcggcgccccggggcccggac
                                                                             ***

G3ULB7_BCL2-02      accaggacctcgccgctccaggctgacccggccgcgcagccggcgctcagcccggtgcca
G3ULB7_BCL2-01      accaggacctcgccgctccaggctgacccggccgcgcagccggcgctcagcccggtgcca
                    ************************************************************

G3ULB7_BCL2-02      cctgtagttcacctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgc
G3ULB7_BCL2-01      cctgtagttcacctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgc
                    ************************************************************

G3ULB7_BCL2-02      gacttcgccgagatgtcgagccagctgcacctgactcccttcaccgcgaggggacgcttt
G3ULB7_BCL2-01      gacttcgccgagatgtcgagccagctgcacctgactcccttcaccgcgaggggacgcttt
                    ************************************************************

G3ULB7_BCL2-02      gccacggtggtggaggagctcttcagggacggggtgaactgggggcggattgtggccttc
G3ULB7_BCL2-01      gccacggtggtggaggagctcttcagggacggggtgaactgggggcggattgtggccttc
                    ************************************************************

G3ULB7_BCL2-02      tttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
G3ULB7_BCL2-01      tttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
                    ************************************************************

G3ULB7_BCL2-02      gacaacatcgccctctggatgactgagtacctgaaccggcacctgcacacctggatccag
G3ULB7_BCL2-01      gacaacatcgccctctggatgactgagtacctgaaccggcacctgcacacctggatccag
                    ************************************************************

G3ULB7_BCL2-02      gataacggaggatgggtaggtgcatgtgtgg-----------------------------
G3ULB7_BCL2-01      gataacggaggatgg---gatgcctttgtggaactgtatggccccaacatgcgacctctg
                    ***************   * *** * *****                             

G3ULB7_BCL2-02      ---------------------ttgaa----------------------------------
G3ULB7_BCL2-01      tttgatttctcctggctgtctctgaagacactgctcagtctggccctggtgggagcttgc
                                          ****                                  

G3ULB7_BCL2-02      ---------------------------------
G3ULB7_BCL2-01      atcaccctgggtgcttacctggggcacaagtga
                                                     

© 1998-2019