Dataset for CDS BCL2L1 of organism Lonchura striata domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A218USB3_BCL2L1-      atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagct
A0A218USB3_BCL2L1-      atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagct
A0A218USB3_BCL2L1-      atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagct
A0A218USB3_BCL2L1-      atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagct
                        **************************************************

A0A218USB3_BCL2L1-      ctcacagaaaggatacagctggagtcagctggaagaggaggatgagaaca
A0A218USB3_BCL2L1-      ctcacagaaaggatacagctggagtcagctggaagaggaggatgagaaca
A0A218USB3_BCL2L1-      ctcacagaaaggatacagctggagtcagctggaagaggaggatgagaaca
A0A218USB3_BCL2L1-      ctcacagaaaggatacagctggagtcagctggaagaggaggatgagaaca
                        **************************************************

A0A218USB3_BCL2L1-      ggactgactttgcaggggaggaggacgagatggacggggtcctcaacggg
A0A218USB3_BCL2L1-      ggactgactttgcaggggaggaggacgagatggacggggtcctcaacggg
A0A218USB3_BCL2L1-      ggactgactttgcaggggaggaggacgagatggacggggtcctcaacggg
A0A218USB3_BCL2L1-      ggactgactttgcaggggaggaggacgagatggacggggtcctcaacggg
                        **************************************************

A0A218USB3_BCL2L1-      agcccctcctggcacgcggccaccagccacatagtgaatggagccactgt
A0A218USB3_BCL2L1-      agcccctcctggcacgcggccaccagccacatagtgaatggagccactgt
A0A218USB3_BCL2L1-      agcccctcctggcacgcggccaccagccacatagtgaatggagccactgt
A0A218USB3_BCL2L1-      agcccctcctggcacgcggccaccagccacatagtgaatggagccactgt
                        **************************************************

A0A218USB3_BCL2L1-      gcaccagagcagcctcgaagtccatgagatccgtcgagcagccgatgtga
A0A218USB3_BCL2L1-      gcaccagagcagcctcgaagtccatgagatccgtcgagcagccgatgtga
A0A218USB3_BCL2L1-      gcaccagagcagcctcgaagtccatgagatccgtcgagcagccgatgtga
A0A218USB3_BCL2L1-      gcaccagagcagcctcgaagtccatgagatccgtcgagcagccgatgtga
                        **************************************************

A0A218USB3_BCL2L1-      ggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgg
A0A218USB3_BCL2L1-      ggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgg
A0A218USB3_BCL2L1-      ggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgg
A0A218USB3_BCL2L1-      ggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgg
                        **************************************************

A0A218USB3_BCL2L1-      gcgttcagcgacctcacttcccagctccacatcactcccagcacagcgta
A0A218USB3_BCL2L1-      gcgttcagcgacctcacttcccagctccacatcactcccagcacagcgta
A0A218USB3_BCL2L1-      gcgttcagcgacctcacttcccagctccacatcactcccagcacagcgta
A0A218USB3_BCL2L1-      gcgttcagcgacctcacttcccagctccacatcactcccagcacagcgta
                        **************************************************

A0A218USB3_BCL2L1-      tcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
A0A218USB3_BCL2L1-      tcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
A0A218USB3_BCL2L1-      tcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
A0A218USB3_BCL2L1-      tcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
                        **************************************************

A0A218USB3_BCL2L1-      ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggag
A0A218USB3_BCL2L1-      ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggag
A0A218USB3_BCL2L1-      ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggag
A0A218USB3_BCL2L1-      ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggag
                        **************************************************

A0A218USB3_BCL2L1-      agcgttgttaaggagatgagggtattggtgaaacgcatcgtgtcttggat
A0A218USB3_BCL2L1-      agcgttgttaaggagatgagggtattggtgaaacgcatcgtgtcttggat
A0A218USB3_BCL2L1-      agcgttgttaaggagatgagggtattggtgaaacgcatcgtgtcttggat
A0A218USB3_BCL2L1-      agcgttgttaaggagatgagggtattggtgaaacgcatcgtgtcttggat
                        **************************************************

A0A218USB3_BCL2L1-      gaccacgtacttgaccgaccacttggatccctggatccaggagaatggcg
A0A218USB3_BCL2L1-      gaccacgtacttgaccgaccacttggatccctggatccaggagaatggcg
A0A218USB3_BCL2L1-      gaccacgtacttgaccgaccacttggatccctggatccaggagaatggcg
A0A218USB3_BCL2L1-      gaccacgtacttgaccgaccacttggatccctggatccaggagaatggcg
                        **************************************************

A0A218USB3_BCL2L1-      gatgggagcgctttgtggacctctatgggaacgatgctgctgccgagatg
A0A218USB3_BCL2L1-      gatgggagcgctttgtggacctctatgggaacgatgctgctgccgagatg
A0A218USB3_BCL2L1-      gatgggagcgctttgtggacctctatgggaacgatgctgctgccgagatg
A0A218USB3_BCL2L1-      gatgggagcgctttgtggacctctatgggaacgatgctgctgccgagatg
                        **************************************************

A0A218USB3_BCL2L1-      agaaaaggccaggagaccttcaacaaatggctcctgaccggggcgacggt
A0A218USB3_BCL2L1-      agaaaaggccaggagaccttcaacaaatggctcctgaccggggcgacggt
A0A218USB3_BCL2L1-      agaaaaggccaggagaccttcaacaaatggctcctgaccggggcgacggt
A0A218USB3_BCL2L1-      agaaaaggccaggagaccttcaacaaatggctcctgaccggggcgacggt
                        **************************************************

A0A218USB3_BCL2L1-      ggccggagtgcttctgctgagcacggactcgtgctgctcatgtcggaccc
A0A218USB3_BCL2L1-      ggccggagtgcttctgct--------------------------------
A0A218USB3_BCL2L1-      ggccggagtgcttctgct--------------------------------
A0A218USB3_BCL2L1-      ggccggagtgcttctgct--------------------------------
                        ******************                                

A0A218USB3_BCL2L1-      gctcagaccccgcatggggagcacgaggattagcattagcccattga---
A0A218USB3_BCL2L1-      ------------------g-------ggatc--------cctgctgagc-
A0A218USB3_BCL2L1-      ------------------g-------ggatc--------cctgctgagc-
A0A218USB3_BCL2L1-      ------------------gagcacgaggattagcattagcccattgaacg
                                          *       ****         **   ***   

A0A218USB3_BCL2L1-      -----------------------
A0A218USB3_BCL2L1-      --------------cgcaagtga
A0A218USB3_BCL2L1-      --------------cgcaagtga
A0A218USB3_BCL2L1-      cttcggtttgcaggtggaggtga
                                               

© 1998-2019