Dataset for CDS BCL-2-like of organism Lepisosteus oculatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

W5N4F7_BCL2-01        atggcaaataacgaagccccgtacgatactcggaatatcgtga-------
W5MG74_BCL2L1-01      aag---a---------tgtcatacagcaacagagacctcgtcg-------
W5MMB7_MCL1-01        atg---agcctctcctcgctgaagcgcacctcggccagcgccgtgataca
                      * *   *               *    *          **          

W5N4F7_BCL2-01        --caaaatacatcca--tcacaaactcctgaagaagggctacgtgtggga
W5MG74_BCL2L1-01      --tctactacatcaa--ctataaactctcgcagaagaactactcctggga
W5MMB7_MCL1-01        gctctattgccccaacgccaccaccattcac------------cccgg--
                           * * *  * *    *  * *                     **  

W5N4F7_BCL2-01        ---atcccgcgtg---------tccggcgagaccgatccccccaataacg
W5MG74_BCL2L1-01      ccagttcagcctgga---------gggcaggaccggaggcgctgaggcgg
W5MMB7_MCL1-01        cctcgccagcctggggccctgtccgggcgggtccgccgcccgcacggctg
                            * ** **            ***  * ***    *         *

W5N4F7_BCL2-01        --gattggtgggcccc---------------tccgcctcgggt-------
W5MG74_BCL2L1-01      tgggttcggggagcccgaacgcagaggagcgtac-----gaacggcgcgg
W5MMB7_MCL1-01        -----tcctggaccccatgctcaaggcggactacgccgaggacgaactgg
                           *   **  ***               * *     *          

W5N4F7_BCL2-01        -----------ccggggctgcaggcgcggcggctccagg-----------
W5MG74_BCL2L1-01      ccaatggcgggggggggcccgtgtcgcgccagcccc--------------
W5MMB7_MCL1-01        acaactactcggcggagcccgtggcg-accagcgcctggatccccaagtc
                                   ** **    * **   * ** **              

W5N4F7_BCL2-01        -------------ctgccggggccgagcgcggagctgtcccggtcccccg
W5MG74_BCL2L1-01      -------------cccaggggatcgag-gcggtgcag-------------
W5MMB7_MCL1-01        gccgcggtcgctgcccgcggggctgaa-gctgggcggccacttcccggag
                                   *    ***   **  ** * ** *             

W5N4F7_BCL2-01        ccggacccccccgcccgacccccacgccgctctccacaaggtgctgcggg
W5MG74_BCL2L1-01      ---------------ggggcgctgcgc----------------------g
W5MMB7_MCL1-01        agcggccacgccgacgggtccctgccctccaccccg-gacaccccgctgg
                                      *  * *  * *                      *

W5N4F7_BCL2-01        aggctggggacgagatcgagaggatgtacca-------------------
W5MG74_BCL2L1-01      actccgccaacgagtttgagctccgctacgg-------------------
W5MMB7_MCL1-01        actgcggcagcgtccccgagttcctctccgaggcccacgggcagctgaac
                      *    *    **     ***      * *                     

W5N4F7_BCL2-01        --------ccgggacttcgcggagatgtcggatcagtt------------
W5MG74_BCL2L1-01      --------ccgggcgttcagcgacctgtcctcccagct------------
W5MMB7_MCL1-01        gcggagacccgggagttaatcgggacctttttgcagatgtacacggggtt
                              *****  **    *     *     *** *            

W5N4F7_BCL2-01        -gcacttcac--------------------------------ccccaac-
W5MG74_BCL2L1-01      -ccacatcac--------------------------------gcccgcc-
W5MMB7_MCL1-01        gccgcaccgccggagccgaggcaaggccctggagaccctgaagcgcgtcg
                        * *  * *                                 * *  * 

W5N4F7_BCL2-01        --------------------------accgcccggag-------------
W5MG74_BCL2L1-01      --------------------------accgcctacca-------------
W5MMB7_MCL1-01        tggacagtgtggtggcgaagcatcagatcgcctaccacggcatgatcgcg
                                                * ****                  

W5N4F7_BCL2-01        --------------------------------gaagttcaccgcggtggt
W5MG74_BCL2L1-01      --------------------------------gagcttcgagcacgtcat
W5MMB7_MCL1-01        aagctggagctggagaacaagggtgaggacgtgagcttcgtgacgggcgt
                                                      **  ***      *   *

W5N4F7_BCL2-01        ggaggag---ctgtttcgggacggagtc---aactgggggcggattgtcg
W5MG74_BCL2L1-01      ggacgaggtc---ttccgggacggggtg---aactgggggcgcatcgtgg
W5MMB7_MCL1-01        ggccaaaagcttgttcagcgacgggaagaccaactggggccgcatcgcca
                      **   *       **  * *****       ******** ** ** *   

W5N4F7_BCL2-01        ctttcttcgagttcggcgggacgatgtgcgtggagagcgtgaaccgggag
W5MG74_BCL2L1-01      ggctcttcgctttcgggggtgcgctgtgcgtggagtgcgtggagaaggag
W5MMB7_MCL1-01        gcctggtgtcgttcg-----gcgcggtg----------gtggccaagcag
                         *  *    ****      **  ***          ***     * **

W5N4F7_BCL2-01        atga------cgtcccaggtggacaacattgc---------caactggat
W5MG74_BCL2L1-01      atgagcaa------cctggtgagccgcatagc---------cgagtggat
W5MMB7_MCL1-01        atgaaggactcgggccgggagagctgcgtggaggcggtgggccaggcgat
                      ****          ** ** *  *  * * *          * *   ***

W5N4F7_BCL2-01        gacggagtatctcaacgggccccttcagaac---tggatccaggagaacg
W5MG74_BCL2L1-01      gaccgtctacctggacaacaacattcagccc---tggatccagagtcagg
W5MMB7_MCL1-01        ctccaactacct--actgcagga-ccagcgcgagtggcttctgaacaacc
                        *    ** **  **         ***  *   *** * * *    *  

W5N4F7_BCL2-01        gaggctgggacgcctttgtggagctctatgggagacagagaggctccatg
W5MG74_BCL2L1-01      gaggatgggacaggtttgcggagatctttggcaaggatgcggctgcggag
W5MMB7_MCL1-01        gaggctgggacggcttcgtggagttcttccgcgtgga---ggaccccgag
                      **** ******   ** * **** ***   *     *    *   *   *

W5N4F7_BCL2-01        ttcagctgttcat-ggccatctttgaagactttctttggtctagctgctc
W5MG74_BCL2L1-01      taccggagatcacaggagagcttcaagaagtggctgctggcgggcatgac
W5MMB7_MCL1-01        t--cgacgat--caggaacgccctga----tggcgtttgccgg-------
                      *   *  * *    **    *    *    *  *    * *         

W5N4F7_BCL2-01        tgggcgcagcaggcctgaccgttggagcctactttacacaaaa------a
W5MG74_BCL2L1-01      tctg-gttacggggctggtggtgggctcctacatcgccaagaaacgctta
W5MMB7_MCL1-01        ---g-gtggcggggctgggcgcggg-gctggccctgctgatcag-----a
                         * *   * ** ***   *  **  *   *    *  *  *      *

W5N4F7_BCL2-01        tga
W5MG74_BCL2L1-01      tag
W5MMB7_MCL1-01        tga

© 1998-2019