Dataset for CDS MCL-1 of organism Latimeria chalumnae

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H3AR18_MCL1-01      -atggaattaccgggggacgggtgc--------ccgc-----------------------
H3AR18_MCL1-02      ggttacaacgccgacggctccgtgccgccttcgccgcccaccccgtcgacccccgaggac
                      *   *   ***  **    ****        ****                       

H3AR18_MCL1-01      -aggacggggacatggcggagtttcgcaaggagacgctgaagctgttgcggagttacttg
H3AR18_MCL1-02      ggggacggggacatggcggagtttcgcaaggagacgctgaagctgttgcggagttacttg

H3AR18_MCL1-01      tgcgaggtggcgggctgcgagagcacggagacggccttcaggttcggtctagatcagtgg
H3AR18_MCL1-02      tgcgaggtggcgggctgcgagagcacggagacggccttcaggttcggtctagatcagtgg

H3AR18_MCL1-01      agcggtggcgagaagccgctggacaccctccggcgggtcggggatagcatcatagacaaa
H3AR18_MCL1-02      agcggtggcgagaagccgctggacaccctccggcgggtcggggatagcatcatagacaaa

H3AR18_MCL1-01      caccgcatcgcctttaatggaatgcaacaaaagctaaacatccataaggaggacgacctc
H3AR18_MCL1-02      caccgcatcgcctttaatggaatgcaacaaaagctaaacatccataaggaggacgacctc

H3AR18_MCL1-01      cacattatacccgaaattggtaaccagatctttaaggacggtgcaacaaactggggtcgc
H3AR18_MCL1-02      cacattatacccgaaattggtaaccagatctttaaggacggtgcaacaaactggggtcgc

H3AR18_MCL1-01      attgttagtcttattgcttttggagcagtcgttgccaagaagctcaaaaagatgaacctg
H3AR18_MCL1-02      attgttagtcttattgcttttggagcagtcgttgccaagaagctcaaaaagatgaacctg

H3AR18_MCL1-01      gaagacagcattgaacagttggcagtgtcgatcacagactttctggtgcagaataaggga
H3AR18_MCL1-02      gaagacagcattgaacagttggcagtgtcgatcacagactttctggtgcagaataaggga

H3AR18_MCL1-01      gactggatcctcaagaaccaaggctggaaaggatttgttgactttttccatgtagaagat
H3AR18_MCL1-02      gactggatcctcaagaaccaaggctggaaaggatttgttgactttttccatgtagaagat

H3AR18_MCL1-01      gcagagggtacaatcaaaaatgtattgatgacatttgcgggcgttgctggactgggtgca
H3AR18_MCL1-02      gcagagggtacaatcaaaaatgtattgatgacatttgcgggcgttgctggactgggtgca

H3AR18_MCL1-01      agtctggtctacttgatgagatga
H3AR18_MCL1-02      agtctggtctacttgatgagatga

© 1998-2019