Dataset for CDS BCL-2-like of organism Latimeria chalumnae

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H3AR18_MCL1-01        -atggaattaccgggggacgggtgc--------ccgc-------------
H3AR18_MCL1-02        ggttacaacgccgacggctccgtgccgccttcgccgcccaccccgtcgac
H3AAS7_BCL2L2-02      -----------------atggattc--gctttacagt-------------
H3AAS7_BCL2L2-01      -----------------atggattc--gctttacagt-------------
H3ANS8_BCL2L1-01      -----------------a-aaatgt--cctt-----c-------------
                                            *                           

H3AR18_MCL1-01        -----------aggacggggacatggcggagtttcgca---aggagacgc
H3AR18_MCL1-02        ccccgaggacggggacggggacatggcggagtttcgca---aggagacgc
H3AAS7_BCL2L2-02      -------------aacagaggagtggtggaggacttcatttattacaaac
H3AAS7_BCL2L2-01      -------------aacagaggagtggtggaggacttcatttattacaaac
H3ANS8_BCL2L1-01      -------------aacaggttgctggtggtggaccatatatcccagaagc
                                    ** *     *** ** *      *      * *  *

H3AR18_MCL1-01        tgaagctgttgcggagttacttgtg-------------------------
H3AR18_MCL1-02        tgaagctgttgcggagttacttgtg-------------------------
H3AAS7_BCL2L2-02      tcggcc---agaaggggtac------------------------------
H3AAS7_BCL2L2-01      tcggcc---agaaggggtac------------------------------
H3ANS8_BCL2L1-01      tgatgc---agcggggataccagtggagggaggttggtgagcaggaccac
                      *    *    *  * * ***                              

H3AR18_MCL1-01        --------------------------------------cgaggtggcggg
H3AR18_MCL1-02        --------------------------------------cgaggtggcggg
H3AAS7_BCL2L2-02      ------------------------------------tctcagcagggtgc
H3AAS7_BCL2L2-01      ------------------------------------tctcagcagggtgc
H3ANS8_BCL2L1-01      ggtggtggaggagaccgcgcgagggaagcacagactcccgaggagggggc
                                                              **  **  * 

H3AR18_MCL1-01        ctgcgagagcacggagacggcc-------ttcaggttcggtctaga-tca
H3AR18_MCL1-02        ctgcgagagcacggagacggcc-------ttcaggttcggtctaga-tca
H3AAS7_BCL2L2-02      c---cca---acggatcccccc-------gccaaccc--------actct
H3AAS7_BCL2L2-01      c---cca---acggatcccccc-------gccaaccc--------actct
H3ANS8_BCL2L1-01      cattccaggcatggacccacccaacggcagccaccctcatgcaggactca
                      *         * ***  *  **         **            * ** 

H3AR18_MCL1-01        gtggagcggt----------------------------------------
H3AR18_MCL1-02        gtggagcggt----------------------------------------
H3AAS7_BCL2L2-02      accgtgcca-----------------------------------------
H3AAS7_BCL2L2-01      accgtgcca-----------------------------------------
H3ANS8_BCL2L1-01      atggtgcggttaacgggttgccggctggcagcagcagccgcctggaagcc
                         * **                                           

H3AR18_MCL1-01        -------------ggcgagaagccgctggac--accctccggcgggtcgg
H3AR18_MCL1-02        -------------ggcgagaagccgctggac--accctccggcgggtcgg
H3AAS7_BCL2L2-02      -------------------------------------tgcgggaggcggg
H3AAS7_BCL2L2-01      -------------------------------------tgcgggaggcggg
H3ANS8_BCL2L1-01      caggcggtgtcggggcccgaagccgtgaaacggacattgcgagaggccgg
                                                           * **   **  **

H3AR18_MCL1-01        ggatagcatcatagacaaacaccgcatcgcctttaatggaatgcaacaaa
H3AR18_MCL1-02        ggatagcatcatagacaaacaccgcatcgcctttaatggaatgcaacaaa
H3AAS7_BCL2L2-02      ggatgagtttgaggcccgcttccaccgcaccttcaactccttgtcgtcac
H3AAS7_BCL2L2-01      ggatgagtttgaggcccgcttccaccgcaccttcaactccttgtcgtcac
H3ANS8_BCL2L1-01      ggaagagtttgagctgaggtatagccgagcattcagtgacctctcttccc
                      ***     *               *    * ** *      *        

H3AR18_MCL1-01        agctaaacatccataaggaggacgacctccacattatacccgaaatt---
H3AR18_MCL1-02        agctaaacatccataaggaggacgacctccacattatacccgaaatt---
H3AAS7_BCL2L2-02      accttcacatc----------acaccgggcacggcttaccggcgatttgc
H3AAS7_BCL2L2-01      accttcacatc----------acaccgggcacggcttaccggcgatttgc
H3ANS8_BCL2L1-01      agctccacatc----------acccccggcacagcctaccagagctttga
                      * **  *****          **  *   ***    **** *   **   

H3AR18_MCL1-01        ------ggtaaccaga-tctttaaggacggtgcaacaaactggggtcgca
H3AR18_MCL1-02        ------ggtaaccaga-tctttaaggacggtgcaacaaactggggtcgca
H3AAS7_BCL2L2-02      tgagacggcagacagcctcttccaggatgg---ggtgaactggggccggg
H3AAS7_BCL2L2-01      tgagacggcagacagcctcttccaggatgg---ggtgaactggggccggg
H3ANS8_BCL2L1-01      acaggtggtgaacgaactcttccgggacgg---agtgaactgggggcgcg
                            **    *    ****   *** **       ******** **  

H3AR18_MCL1-01        ttgttagtcttattgcttttggagcagt------cgttgccaagaagctc
H3AR18_MCL1-02        ttgttagtcttattgcttttggagcagt------cgttgccaagaagctc
H3AAS7_BCL2L2-02      tggtggcgctgttcgtcttcagcgcagcactctgtgtggagagcgtggat
H3AAS7_BCL2L2-01      tggtggcgctgttcgtcttcagcgcagcactctgtgtggagagcgtggat
H3ANS8_BCL2L1-01      tggtggctttctttgcctttggaggggcgttgtgtgtggagagtatggac
                      * **     *  * *  **  * *  *        ** *  *    *   

H3AR18_MCL1-01        aaaaagatgaacctggaagacagcattgaacagttggcagtgtcgatcac
H3AR18_MCL1-02        aaaaagatgaacctggaagacagcattgaacagttggcagtgtcgatcac
H3AAS7_BCL2L2-02      aaggaaatggcttcgctgg------tgggacggattattgactggacagt
H3AAS7_BCL2L2-01      aaggaaatggcttcgctgg------tgggacggattattgactggacagt
H3ANS8_BCL2L1-01      aaggagatgtcttcactag------tagagcggatcgctgagtggatgac
                      **  * ***         *      * *  * * *    *  * **    

H3AR18_MCL1-01        agactttctggtgcagaataagggagactggatcctcaagaaccaaggct
H3AR18_MCL1-02        agactttctggtgcagaataagggagactggatcctcaagaaccaaggct
H3AAS7_BCL2L2-02      aacttatgtagagagcagccttcaggattggatcaaccacagtggaggat
H3AAS7_BCL2L2-01      aacttatgtagagagcagccttcaggattggatcaaccacagtggaggat
H3ANS8_BCL2L1-01      gacttacctagatgataacttaaacccttggattcaggaacaaggaggat
                          *   * *     *           *****     *      *** *

H3AR18_MCL1-01        ggaaaggatttgttgactttttccatgtagaag-----atgcagagggta
H3AR18_MCL1-02        ggaaaggatttgttgactttttccatgtagaag-----atgcagagggta
H3AAS7_BCL2L2-02      ggagtgctttcgtgtgtctgt---atgggaatg-----gtgcagtgggcg
H3AAS7_BCL2L2-01      ggagtgctttcgtgtgtctgt---atgggaatg-----gtgcagtgggcg
H3ANS8_BCL2L1-01      gggcaaccataatacacattg---acggggttgacgctatgcagcgctca
                      **       *  *     *     * *     *      ***** *    

H3AR18_MCL1-01        caatcaaaaatgtat----------------------tgatgac------
H3AR18_MCL1-02        caatcaaaaatgtat----------------------tgatgac------
H3AAS7_BCL2L2-02      ga-gccaggaggtttcaggaaggctactggtcatccatgaagac---ggt
H3AAS7_BCL2L2-01      ga-gccaggaggtttcaggaaggctactggtcatccatgaagac---ggt
H3ANS8_BCL2L1-01      aacaccaggag--------------------------tgaaaaattgggt
                       *  * *  *                           ***  *       

H3AR18_MCL1-01        atttgcgggcgttgct------------------ggactgggtgcaagtc
H3AR18_MCL1-02        atttgcgggcgttgct------------------ggactgggtgcaagtc
H3AAS7_BCL2L2-02      tgtgacgggggctgtgg-----------cgctaggggcggtgatgacggt
H3AAS7_BCL2L2-01      tgtgacgggggctgtgg-----------cgctaggggcggtgatgacggt
H3ANS8_BCL2L1-01      tttgttgggttttttttttcctttcttctgcgtggggtggaaagaaacct
                        *   ***   *                     **   *     *    

H3AR18_MCL1-01        tggtctacttgatg-----agatga
H3AR18_MCL1-02        tggtctacttgatg-----agatga
H3AAS7_BCL2L2-02      cggagcgctttttgccagcagataa
H3AAS7_BCL2L2-01      cggagcgctttttgccagcagataa
H3ANS8_BCL2L1-01      c-aaactctttttgc--gcaaatga
                             ***  **     * ** *

© 1998-2018