Dataset for CDS BCL2L2 of organism Latimeria chalumnae

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H3AAS7_BCL2L2-01      atggattcgctttacagtaacagaggagtggtggaggacttcatttatta
H3AAS7_BCL2L2-02      atggattcgctttacagtaacagaggagtggtggaggacttcatttatta

H3AAS7_BCL2L2-01      caaactcggccagaaggggtactctcagcagggtgccccaacggatcccc
H3AAS7_BCL2L2-02      caaactcggccagaaggggtactctcagcagggtgccccaacggatcccc

H3AAS7_BCL2L2-01      ccgccaacccactctaccgtgccatgcgggaggcgggggatgagtttgag
H3AAS7_BCL2L2-02      ccgccaacccactctaccgtgccatgcgggaggcgggggatgagtttgag

H3AAS7_BCL2L2-01      gcccgcttccaccgcaccttcaactccttgtcgtcacaccttcacatcac
H3AAS7_BCL2L2-02      gcccgcttccaccgcaccttcaactccttgtcgtcacaccttcacatcac

H3AAS7_BCL2L2-01      accgggcacggcttaccggcgatttgctgagacggcagacagcctcttcc
H3AAS7_BCL2L2-02      accgggcacggcttaccggcgatttgctgagacggcagacagcctcttcc

H3AAS7_BCL2L2-01      aggatggggtgaactggggccgggtggtggcgctgttcgtcttcagcgca
H3AAS7_BCL2L2-02      aggatggggtgaactggggccgggtggtggcgctgttcgtcttcagcgca

H3AAS7_BCL2L2-01      gcactctgtgtggagagcgtggataaggaaatggcttcgctggtgggacg
H3AAS7_BCL2L2-02      gcactctgtgtggagagcgtggataaggaaatggcttcgctggtgggacg

H3AAS7_BCL2L2-01      gattattgactggacagtaacttatgtagagagcagccttcaggattgga
H3AAS7_BCL2L2-02      gattattgactggacagtaacttatgtagagagcagccttcaggattgga

H3AAS7_BCL2L2-01      tcaaccacagtggaggatggagtgctttcgtgtgtctgtatgggaatggt
H3AAS7_BCL2L2-02      tcaaccacagtggaggatggagtgctttcgtgtgtctgtatgggaatggt

H3AAS7_BCL2L2-01      gcagtgggcggagccaggaggtttcaggaaggctactggtcatccatgaa
H3AAS7_BCL2L2-02      gcagtgggcggagccaggaggtttcaggaaggctactggtcatccatgaa

H3AAS7_BCL2L2-01      gacggttgtgacgggggctgtggcgctaggggcggtgatgacggtcggag
H3AAS7_BCL2L2-02      gacggttgtgacgggggctgtggcgctaggggcggtgatgacggtcggag

H3AAS7_BCL2L2-01      cgctttttgccagcagataa
H3AAS7_BCL2L2-02      cgctttttgccagcagataa

© 1998-2019