Dataset for CDS BCL2L1 of organism Labrus bergylta

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3FUB6_BCL2L1-      atgtcatacagtaacagagagctggtggagttcttcataagctacaaact
A0A3Q3G2E1_BCL2L1-      atgtctcaa---aacagagaactagtggttttctacataacctataaatt
A0A3Q3G2E1_BCL2L1-      atgtctcaa---aacagagaactagtggttttctacataacctataaatt
A0A3Q3G2E1_BCL2L1-      atgtctcaa---aacagagaactagtggttttctacataacctataaatt
                        *****  *    ******** ** ****  **** ***** *** *** *

A0A3Q3FUB6_BCL2L1-      gtctcagaggaactatcc-----------------------aacctatgt
A0A3Q3G2E1_BCL2L1-      ctctcagagaaattatcctcttaatcacatggaactcttagagcctccaa
A0A3Q3G2E1_BCL2L1-      ctctcagagaaattatcctcttaatcacatggaactcttagagcctccaa
A0A3Q3G2E1_BCL2L1-      ctctcagagaaattatcctcttaatcacatggaactcttagagcctccaa
                         ******** ** *****                       * ***    

A0A3Q3FUB6_BCL2L1-      gctgaggtcagaggatgctggtgaaaggactgagggagacatggaaaact
A0A3Q3G2E1_BCL2L1-      ac--aggactgatggggc-gggggcagggtcgggtgaggaacagcaggta
A0A3Q3G2E1_BCL2L1-      ac--aggactgatggggc-gggggcagggtcgggtgaggaacagcaggta
A0A3Q3G2E1_BCL2L1-      ac--aggactgatggggc-gggggcagggtcgggtgaggaacagcaggta
                         *  *** * ** *  ** ** *  ***   * * ***  *  * *    

A0A3Q3FUB6_BCL2L1-      ctgctgc-cagtaatggctttttggtcaacagca--------ggaaccgg
A0A3Q3G2E1_BCL2L1-      gcgacgcacgccaacgggactt---ttaacggcacgagtcctggaacccc
A0A3Q3G2E1_BCL2L1-      gcgacgcacgccaacgggactt---ttaacggcacgagtcctggaacccc
A0A3Q3G2E1_BCL2L1-      gcgacgcacgccaacgggactt---ttaacggcacgagtcctggaacccc
                          *  ** *   ** **   **   * *** ***        ******  

A0A3Q3FUB6_BCL2L1-      gccggc---------cagtcagtgatgtcatcatccccacacaccgaca-
A0A3Q3G2E1_BCL2L1-      cccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacga
A0A3Q3G2E1_BCL2L1-      cccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacga
A0A3Q3G2E1_BCL2L1-      cccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacga
                         ** **         * * ***      ** *     *   ** ****  

A0A3Q3FUB6_BCL2L1-      ---tagaggctgtaaaggcagctcttctggactctgcagatgagtttgag
A0A3Q3G2E1_BCL2L1-      atctggacgcggtgaaggaggccctccgggactcggccaacgagtttgag
A0A3Q3G2E1_BCL2L1-      atctggacgcggtgaaggaggccctccgggactcggccaacgagtttgag
A0A3Q3G2E1_BCL2L1-      atctggacgcggtgaaggaggccctccgggactcggccaacgagtttgag
                           * ** ** ** ****  ** ** * ****** **  * *********

A0A3Q3FUB6_BCL2L1-      cttctctttacgcaggcctttagtgacctttcctcgcagcttgacattac
A0A3Q3G2E1_BCL2L1-      ctgcgatatgccagcgccttcagcgatctgcacaaccagctgcacatcac
A0A3Q3G2E1_BCL2L1-      ctgcgatatgccagcgccttcagcgatctgcacaaccagctgcacatcac
A0A3Q3G2E1_BCL2L1-      ctgcgatatgccagcgccttcagcgatctgcacaaccagctgcacatcac
                        ** *  * * *    ***** ** ** **   *   *****  **** **

A0A3Q3FUB6_BCL2L1-      tcccaacacagcctatcacagctttaagagtgtgatggacgaggttttca
A0A3Q3G2E1_BCL2L1-      gccggccacaacccaccagagctttgagaacgtgatggacgaggtgttcc
A0A3Q3G2E1_BCL2L1-      gccggccacaacccaccagagctttgagaacgtgatggacgaggtgttcc
A0A3Q3G2E1_BCL2L1-      gccggccacaacccaccagagctttgagaacgtgatggacgaggtgttcc
                         **   **** ** * ** ****** ***  ************** *** 

A0A3Q3FUB6_BCL2L1-      aggatggagtcaactgggggcgtatagtaggcctgtttgcctttggcggt
A0A3Q3G2E1_BCL2L1-      gggacggagtcaactggggccgcatcgtggggctctttgctttcggcggg
A0A3Q3G2E1_BCL2L1-      gggacggagtcaactggggccgcatcgtggggctctttgctttcggcggg
A0A3Q3G2E1_BCL2L1-      gggacggagtcaactggggccgcatcgtggggctctttgctttcggcggg
                         *** ************** ** ** ** ** ** ***** ** ***** 

A0A3Q3FUB6_BCL2L1-      gtactgtgtgtggaatgcgtccagaaggatatgggtgaactggtttcccg
A0A3Q3G2E1_BCL2L1-      gcgctgtgtgtcgagtgcgtggagaaggagatgagtcccctcgttggcag
A0A3Q3G2E1_BCL2L1-      gcgctgtgtgtcgagtgcgtggagaaggagatgagtcccctcgttggcag
A0A3Q3G2E1_BCL2L1-      gcgctgtgtgtcgagtgcgtggagaaggagatgagtcccctcgttggcag
                        *  ******** ** *****  ******* *** **   ** ***  * *

A0A3Q3FUB6_BCL2L1-      catcgcaggctggatgactacgtacctggatgagcacattagtgcatgga
A0A3Q3G2E1_BCL2L1-      gatcatagagtggatgactgtctacctggacaaccgaattcaaccttgga
A0A3Q3G2E1_BCL2L1-      gatcatagagtggatgactgtctacctggacaaccgaattcaaccttgga
A0A3Q3G2E1_BCL2L1-      gatcatagagtggatgactgtctacctggacaaccgaattcaaccttgga
                         ***  **  *********   ********  * *  ***    * ****

A0A3Q3FUB6_BCL2L1-      tcgagagccagggaggatgggactgctttgttgaaattttcggacggggc
A0A3Q3G2E1_BCL2L1-      tcgagagccaaggaggatgggagcgcttctctgaaatctttgggcaggat
A0A3Q3G2E1_BCL2L1-      tcgagagccaaggaggatgggagcgcttctctgaaatctttgggcaggat
A0A3Q3G2E1_BCL2L1-      tcgagagccaaggaggatgggagcgcttctctgaaatctttgggcaggat
                        ********** ***********  ****   ****** ** ** * **  

A0A3Q3FUB6_BCL2L1-      gctgttggagaagtgaggagatctcgggaaactctcaccagatggctgct
A0A3Q3G2E1_BCL2L1-      gcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgct
A0A3Q3G2E1_BCL2L1-      gcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgct
A0A3Q3G2E1_BCL2L1-      gcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgct
                        ** *  *****  * ***** **** *** * * ***  *  ********

A0A3Q3FUB6_BCL2L1-      agttggaatggcgctgctaatgggagtcgtggttggtgtttacatcgcta
A0A3Q3G2E1_BCL2L1-      ggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgccc
A0A3Q3G2E1_BCL2L1-      ggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgccc
A0A3Q3G2E1_BCL2L1-      ggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgccc
                         *  ** *** ***** * *  ** ******** **      ******  

A0A3Q3FUB6_BCL2L1-      agaaacat---taa
A0A3Q3G2E1_BCL2L1-      agaaacgcctgtag
A0A3Q3G2E1_BCL2L1-      agaaacgcctgtag
A0A3Q3G2E1_BCL2L1-      agaaacgcctgtag
                        ******     ** 

© 1998-2019