Dataset for CDS MCL-1 of organism Kryptolebias marmoratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3B4V7_MCL1-01      atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagt
A0A3Q3B4V7_MCL1-02      atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagt
                        **************************************************

A0A3Q3B4V7_MCL1-01      cgtggacggattacacagagacacctctccccaggtctccattggcgcct
A0A3Q3B4V7_MCL1-02      cgtggacggattacacagagacacctctccccaggtctccattggcgcct
                        **************************************************

A0A3Q3B4V7_MCL1-01      cgctaggctccgagaacggcagcgtggcgtcgtgcaattcctccaaacga
A0A3Q3B4V7_MCL1-02      cgctaggctccgagaacggcagcgtggcgtcgtgcaattcctccaaacga
                        **************************************************

A0A3Q3B4V7_MCL1-01      ccgaaggacctggtgatgcctccgctgaagggataccaagacaagcgctt
A0A3Q3B4V7_MCL1-02      ccgaaggacctggtgatgcctccgctgaagggataccaagacaagcgctt
                        **************************************************

A0A3Q3B4V7_MCL1-01      tcaggagctcggcgacgaccacggctcgttaccgagcacgccggaggtgg
A0A3Q3B4V7_MCL1-02      tcaggagctcggcgacgaccacggctcgttaccgagcacgccggaggtgg
                        **************************************************

A0A3Q3B4V7_MCL1-01      acggtaaccccgacgtccccggcggtgctgaggacgaagtgctggagaac
A0A3Q3B4V7_MCL1-02      acggtaaccccgacgtccccggcggtgctgaggacgaagtgctggagaac
                        **************************************************

A0A3Q3B4V7_MCL1-01      gacacgaagcatctgatcagccgtttcctacaagagtttactggactatc
A0A3Q3B4V7_MCL1-02      gacacgaagcatctgatcagccgtttcctacaagagtttactggactatc
                        **************************************************

A0A3Q3B4V7_MCL1-01      aaaacgtcagtggtcagagagtaaggagttatcgacgatgaacagagtgg
A0A3Q3B4V7_MCL1-02      aaaacgtcagtggtcagagagtaaggagttatcgacgatgaacagagtgg
                        **************************************************

A0A3Q3B4V7_MCL1-01      tggaggaccttttgacaaaacacagattcgcgtacaatggtataatcaag
A0A3Q3B4V7_MCL1-02      tggaggaccttttgacaaaacacagattcgcgtacaatggtataatcaag
                        **************************************************

A0A3Q3B4V7_MCL1-01      aaactgtctttggatgacaaaagtgaggacatgacgtttgtaacaaaaac
A0A3Q3B4V7_MCL1-02      aaactgtctttggatgacaaaagtgaggacatgacgtttgtaacaaaaac
                        **************************************************

A0A3Q3B4V7_MCL1-01      agcccggagccttttcgcagacgggatcaccaactggggtcggatctcca
A0A3Q3B4V7_MCL1-02      agcccggagccttttcgcagacgggatcaccaactggggtcggatctcca
                        **************************************************

A0A3Q3B4V7_MCL1-01      gcctggtggcctttggcgcagtggtggcggtgcacctgaaggagaagggg
A0A3Q3B4V7_MCL1-02      gcctggtggcctttggcgcagtggtggcggtgcacctgaaggagaagggg
                        **************************************************

A0A3Q3B4V7_MCL1-01      agggaggaatgcgtggagctggtgggccaggagatttccacatacctgct
A0A3Q3B4V7_MCL1-02      agggaggaatgcgtggagctggtgggccaggagatttccacatacctgct
                        **************************************************

A0A3Q3B4V7_MCL1-01      gtctgagcagaaagactggctgctcaaaaataactcctggagtggctttg
A0A3Q3B4V7_MCL1-02      gtctgagcagaaagactggctgctcaaaaataactcctggagtggctttg
                        **************************************************

A0A3Q3B4V7_MCL1-01      tggagttctttcgaataacagaccctgaatctacagtcaggaacacactg
A0A3Q3B4V7_MCL1-02      tggagttctttcgaataacagaccctgaatctacagtcaggaacacactg
                        **************************************************

A0A3Q3B4V7_MCL1-01      atggctgtagccggatttgctgggcttggggcaacactggccttattgat
A0A3Q3B4V7_MCL1-02      atggctgtagccggatttgctgggcttggggcaacactggccttattgat
                        **************************************************

A0A3Q3B4V7_MCL1-01      aagtgttt------------------------------------------
A0A3Q3B4V7_MCL1-02      aagcacttggtcagcaaaatgtgagcacaggcctctggaaaatgaatcat
                        ***   **                                          

A0A3Q3B4V7_MCL1-01      --------------------------------------------------
A0A3Q3B4V7_MCL1-02      gtgtatctctggcgcctgggatcagaagttgctacctaagcacaaccaca
                                                                          

A0A3Q3B4V7_MCL1-01      -------gttgg--------------------------------------
A0A3Q3B4V7_MCL1-02      catttaagttgggcagcagaaatctgggctgcaggtgtggatcaacagga
                               *****                                      

A0A3Q3B4V7_MCL1-01      ---------ccttga-----------------------------------
A0A3Q3B4V7_MCL1-02      tgagtcaaaccttaatattgggtggatcctgcctcttcacaatgactgct
                                 **** *                                   

A0A3Q3B4V7_MCL1-01      -----------------------------------------------
A0A3Q3B4V7_MCL1-02      ggagacaggcaccagctccctgcgtctctgcagggaaaagggagtaa
                                                                       

© 1998-2019