Dataset for CDS BCL2L1 of organism Kryptolebias marmoratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3B3X5_BCL2L1-      atgtctca---aaacaaagaactggtgcttttctatattatgtataaact
A0A3Q3BEB7_BCL2L1-      atgtcacacagcaacagagatctggtgcagttctacataagctataagtt
                        ***** **    **** *** *******  ***** ** *  *****  *

A0A3Q3B3X5_BCL2L1-      gtcacagagaaactatcctgtcaatcacataatactcagtgatcctccga
A0A3Q3BEB7_BCL2L1-      gtctcagaggaactgttc---------------------gaagtctctg-
                        *** ***** **** * *                       *  *** * 

A0A3Q3B3X5_BCL2L1-      atagaactgatgcaggggatgcagggttggaggacgcagagatgacagag
A0A3Q3BEB7_BCL2L1-      ------ctgatgccggaggttgccggtgaaaggaccgaga----------
                              ******* ** * *    ***   *****  ***          

A0A3Q3B3X5_BCL2L1-      acacacgccaatgggacttt---taacgggactagtcctgggaccccgcc
A0A3Q3BEB7_BCL2L1-      ----aggccagctcggctcccagtaacgg--cttg--ctggtcaacagta
                            * ****    * **     ******  ** *  ****    * *  

A0A3Q3B3X5_BCL2L1-      ggcgtccccactgaggcagcaaccgctg--ccgacgacggcgaacatgga
A0A3Q3BEB7_BCL2L1-      gggacggccagtcggggaagaagatctggccccgccgcagcg-acataga
                        **     *** *  ** *  **   ***  **  *  * *** **** **

A0A3Q3B3X5_BCL2L1-      caaggtgaaggaagctctccgggacacggcaaacgagttcgagctgcggt
A0A3Q3BEB7_BCL2L1-      ggccgtaaaatcagctctgaaggactctgcggatgagtttgagcgtctct
                            ** **   ******   **** * **  * ***** ****  *  *

A0A3Q3B3X5_BCL2L1-      acgcccgcgctttcagcgacctgcacagccagctgcacatcacgcccggc
A0A3Q3BEB7_BCL2L1-      acacgcaaagtttcagccacctgtccctgcagctcgacatcagccccgac
                        ** * *    ******* *****  *   *****  ******  **** *

A0A3Q3B3X5_BCL2L1-      accgtctaccaaagcttcgagaacgtgatggacgaggtgttccgggacgg
A0A3Q3BEB7_BCL2L1-      acggtctaccacagcttcaagagcgtgctggacgagctgttcaaggacgg
                        ** ******** ****** *** **** ******** *****  ******

A0A3Q3B3X5_BCL2L1-      cgtcaactggggccgcattgtggggctctttgcattcggcggagcgctgt
A0A3Q3BEB7_BCL2L1-      ggtgaactggggccgcgtggtgggcctgtttgccttcggcggcgtgctgt
                         ** ************ * ***** ** ***** ******** * *****

A0A3Q3B3X5_BCL2L1-      gcgtcgagtgcgtcgagaaggagatgagtcacctggtggccaggattgtg
A0A3Q3BEB7_BCL2L1-      gcgttcagtgcgtcgagagggacatgagtgagctggtctcccgcattgca
                        ****  ************ *** ****** * *****  ** * ****  

A0A3Q3B3X5_BCL2L1-      gagtggatgaccgtctacctggacaaccacattcagccttggattcagag
A0A3Q3BEB7_BCL2L1-      gactggatgaccgtttacctggatgagcagatcggtccgtggatcgacag
                        ** *********** ********  * ** **    ** *****  * **

A0A3Q3B3X5_BCL2L1-      tcaagggggatgggagcgctttgctgaaatcttcggcgacaacgcggcgg
A0A3Q3BEB7_BCL2L1-      ccagggaggatgggacagcttcgctgagatgtacgggcgagatgccgctg
                         ** ** ********  **** ***** ** * ***     * ** ** *

A0A3Q3B3X5_BCL2L1-      ctgaaagcagaatctctcaggagggtttaaagaagtggctgctggtgggg
A0A3Q3BEB7_BCL2L1-      cagaagcgaggaggtttcaggagtccctgaagaaatggctgctagctgga
                        * ***   ** *  * *******    * ***** ******** *  ** 

A0A3Q3B3X5_BCL2L1-      atgacggtggtgaccgcggtggtggcgggttcgctcttcgcccagaagcg
A0A3Q3BEB7_BCL2L1-      gcggcgctgctggctgggctgcttctcggcgtgctcgtggctaagaagcg
                          * ** ** ** * * * ** *    **   **** * **  *******

A0A3Q3B3X5_BCL2L1-      cctgtga
A0A3Q3BEB7_BCL2L1-      t---taa
                            * *

© 1998-2019