Dataset for CDS MCL-1 of organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287DCH9_MCL1-01      atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgg
A0A287DCH9_MCL1-02      atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgg
                        **************************************************

A0A287DCH9_MCL1-01      gggcgccgggctgggggccagcggcggcgccaccccgccgggagcgcagc
A0A287DCH9_MCL1-02      g-------------------------------------------------
                        *                                                 

A0A287DCH9_MCL1-01      tcttagccgccgagaaggaggccgcggcccggcgagaggcagggggaggg
A0A287DCH9_MCL1-02      --------------------------------------------------
                                                                          

A0A287DCH9_MCL1-01      gaagccgcccagccgcccagcgcccgcagggtcgcgcggccggtgcccat
A0A287DCH9_MCL1-02      --------------------------------------------------
                                                                          

A0A287DCH9_MCL1-01      tggcgccgaggtccccgacgtcaccgcgaccccggcgaggcgactctttt
A0A287DCH9_MCL1-02      -ggcgccgaggtccccgacgtcaccgcgaccccggcgaggcgactctttt
                         *************************************************

A0A287DCH9_MCL1-01      tcgcgcccacctactgcgtgtcgccgcctgagaagatggaagcccccgcc
A0A287DCH9_MCL1-02      tcgcgcccacctactgcgtgtcgccgcctgagaagatggaagcccccgcc
                        **************************************************

A0A287DCH9_MCL1-01      gccgccatgtcgcccgaagaggagctggacggctacgagcccgagcccct
A0A287DCH9_MCL1-02      gccgccatgtcgcccgaagaggagctggacggctacgagcccgagcccct
                        **************************************************

A0A287DCH9_MCL1-01      cgggaagcggccggcggtcctgcccttgctggagctcgttggagaggccg
A0A287DCH9_MCL1-02      cgggaagcggccggcggtcctgcccttgctggagctcgttggagaggccg
                        **************************************************

A0A287DCH9_MCL1-01      ccaagagtcccggcgcggacgggtcgctgccctcgacgccgccgcccgcg
A0A287DCH9_MCL1-02      ccaagagtcccggcgcggacgggtcgctgccctcgacgccgccgcccgcg
                        **************************************************

A0A287DCH9_MCL1-01      gaggaggaggacgacgagctgtaccggcagtcgctggagatcatttcgcg
A0A287DCH9_MCL1-02      gaggaggaggacgacgagctgtaccggcagtcgctggagatcatttcgcg
                        **************************************************

A0A287DCH9_MCL1-01      gtacctccgcgagcaggcgaccggctccaaggacgcgaagccgctgcgtg
A0A287DCH9_MCL1-02      gtacctccgcgagcaggcgaccggctccaaggacgcgaagccgctgcgtg
                        **************************************************

A0A287DCH9_MCL1-01      ggtcgggggccgccagcaggaaggcgctggagaccctgcggcgggtcggc
A0A287DCH9_MCL1-02      ggtcgggggccgccagcaggaaggcgctggagaccctgcggcgggtcggc
                        **************************************************

A0A287DCH9_MCL1-01      gacggagtgcagcgcaaccacgagacggccttccaaggcatgcttcggaa
A0A287DCH9_MCL1-02      gacggagtgcagcgcaaccacgagacggccttccaaggcatgcttcggaa
                        **************************************************

A0A287DCH9_MCL1-01      gctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatgg
A0A287DCH9_MCL1-02      gctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatgg
                        **************************************************

A0A287DCH9_MCL1-01      tccatgttttcagtgacggagtaacaaactggggcaggattgtgactctc
A0A287DCH9_MCL1-02      tccatgttttcagtgacggagtaacaaactggggcaggattgtgactctc
                        **************************************************

A0A287DCH9_MCL1-01      atttcttttggtgcctttgtggccaaacacttgaagagcataaaccaaga
A0A287DCH9_MCL1-02      atttcttttggtgcctttgtggccaaacacttgaagagcataaaccaaga
                        **************************************************

A0A287DCH9_MCL1-01      aagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaagga
A0A287DCH9_MCL1-02      aagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaagga
                        **************************************************

A0A287DCH9_MCL1-01      caaaacgggactggctggtcaaacaaagaggctgggatgggtttgtggag
A0A287DCH9_MCL1-02      caaaacgggactggctggtcaaacaaagaggctgggatgggtttgtggag
                        **************************************************

A0A287DCH9_MCL1-01      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A287DCH9_MCL1-02      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
                        **************************************************

A0A287DCH9_MCL1-01      tttcgcaggtgttgctggcgtaggagctggtttggcatatctaataagat
A0A287DCH9_MCL1-02      tttcgcaggtgttgctggcgtaggagctggtttggcatatctaataagat
                        **************************************************

A0A287DCH9_MCL1-01      ag
A0A287DCH9_MCL1-02      ag
                        **

© 1998-2018