Dataset for CDS BCL-2-like of organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

I3MCZ7_BCL2A1-01        atg------------------------------------aatgactgtga
I3MVK9_BCL2-01          atggctcacgctggga-gaacagggt-----------atgataaccggga
A0A287DCH9_MCL1-01      atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgg
A0A287DCH9_MCL1-02      atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgg
A0A287CZ07_BCL2L1-      at----------------------gtctc--------agagcaaccggga
I3MUP5_BCL2L1-03        at----------------------gtctc--------agagcaaccggga
I3MUP5_BCL2L1-01        at----------------------gtctc--------agagcaaccggga
I3MUP5_BCL2L1-02        at----------------------gtctc--------agagcaaccggga
I3ND50_BCL2L2-01        atggcgacccc------agcctcggcccc--------aga-cacacgggc
I3ND50_BCL2L2-02        atggcgacccc------agcctcggcccc--------aga-cacacgggc
                        **                                            * * 

I3MCZ7_BCL2A1-01        g-------------------------------------------------
I3MVK9_BCL2-01          g-------------------------------------------------
A0A287DCH9_MCL1-01      gggcgccgggctgggggccagcggcggcgccaccccgccgggagcgcagc
A0A287DCH9_MCL1-02      g-------------------------------------------------
A0A287CZ07_BCL2L1-      g-------------------------------------------------
I3MUP5_BCL2L1-03        g-------------------------------------------------
I3MUP5_BCL2L1-01        g-------------------------------------------------
I3MUP5_BCL2L1-02        g-------------------------------------------------
I3ND50_BCL2L2-01        t-------------------------------------------------
I3ND50_BCL2L2-02        t-------------------------------------------------

I3MCZ7_BCL2A1-01        --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
A0A287DCH9_MCL1-01      tcttagccgccgagaaggaggccgcggcccggcgagaggcagggggaggg
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------

I3MCZ7_BCL2A1-01        --------------------------------------------------
I3MVK9_BCL2-01          -------------------------------------------------a
A0A287DCH9_MCL1-01      gaagccgcccagccgcccagcgcccgcagggtcgcgcggccggtgcccat
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287CZ07_BCL2L1-      -------------------------------------------------c
I3MUP5_BCL2L1-03        -------------------------------------------------c
I3MUP5_BCL2L1-01        -------------------------------------------------c
I3MUP5_BCL2L1-02        -------------------------------------------------c
I3ND50_BCL2L2-01        -------------------------------------------------c
I3ND50_BCL2L2-02        -------------------------------------------------c

I3MCZ7_BCL2A1-01        -----ttcaggttcatccacac-----gctggctcaggac----------
I3MVK9_BCL2-01          tagtgatgaagtacatccactataa--gctgtcacagaggggcta-----
A0A287DCH9_MCL1-01      tggcgccgaggtcc--ccgacgtcaccgcgaccccggcgaggcgactctt
A0A287DCH9_MCL1-02      -ggcgccgaggtcc--ccgacgtcaccgcgaccccggcgaggcgactctt
A0A287CZ07_BCL2L1-      tggtggttgactttctctcctacaa--gctttcccagaaaggata-----
I3MUP5_BCL2L1-03        tggtggttgactttctctcctacaa--gctttcccagaaaggata-----
I3MUP5_BCL2L1-01        tggtggttgactttctctcctacaa--gctttcccagaaaggata-----
I3MUP5_BCL2L1-02        tggtggttgactttctctcctacaa--gctttcccagaaaggata-----
I3ND50_BCL2L2-01        tggtggccgactttgtaggctataa--gctgaggcagaagggtta-----
I3ND50_BCL2L2-02        tggtggccgactttgtaggctataa--gctgaggcagaagggtta-----
                                   *               **     * *             

I3MCZ7_BCL2A1-01        --------------------------tacctgca----------------
I3MVK9_BCL2-01          --------------------------cgagtggg----------------
A0A287DCH9_MCL1-01      tttcgcgcccacctactgcgtgtcgccgcctgag----------------
A0A287DCH9_MCL1-02      tttcgcgcccacctactgcgtgtcgccgcctgag----------------
A0A287CZ07_BCL2L1-      --------------------------cagctggagtcagtttagcgatgt
I3MUP5_BCL2L1-03        --------------------------cagctggagtcagtttagcgatgt
I3MUP5_BCL2L1-01        --------------------------cagctggagtcagtttagcgatgt
I3MUP5_BCL2L1-02        --------------------------cagctggagtcagtttagcgatgt
I3ND50_BCL2L2-01        --------------------------cgtct-------------------
I3ND50_BCL2L2-02        --------------------------cgtct-------------------

I3MCZ7_BCL2A1-01        ----------------gcacgtcctgcaggtaccgcaacgtgggtcaag-
I3MVK9_BCL2-01          ----------atgctggaga----cgtgggcgctgcgtcccc-----agg
A0A287DCH9_MCL1-01      ----------aagatggaagcccccgccgccgccatgtcgcccgaagagg
A0A287DCH9_MCL1-02      ----------aagatggaagcccccgccgccgccatgtcgcccgaagagg
A0A287CZ07_BCL2L1-      ggaagagaacaggactgaagccccagaagggactgaatcagaggtggaga
I3MUP5_BCL2L1-03        ggaagagaacaggactgaagccccagaagggactgaatcagaggtggaga
I3MUP5_BCL2L1-01        ggaagagaacaggactgaagccccagaagggactgaatcagaggtggaga
I3MUP5_BCL2L1-02        ggaagagaacaggactgaagccccagaagggactgaatcagaggtggaga
I3ND50_BCL2L2-01        -------------------------------------------gtggag-
I3ND50_BCL2L2-02        -------------------------------------------gtggag-

I3MCZ7_BCL2A1-01        ---------------------------------ccccagcaaaacgtc--
I3MVK9_BCL2-01          agc----cgcccccgggccgggcatcttctcttcccaaccggggagccat
A0A287DCH9_MCL1-01      agctggacggctacgagcccgagcccctcgggaagcggccggcg-gtcct
A0A287DCH9_MCL1-02      agctggacggctacgagcccgagcccctcgggaagcggccggcg-gtcct
A0A287CZ07_BCL2L1-      cccccagtgccatcaatggcaacccatcctggcatctggccgacagcccc
I3MUP5_BCL2L1-03        cccccagtgccatcaatggcaacccatcctggcatctggccgacagcccc
I3MUP5_BCL2L1-01        cccccagtgccatcaatggcaacccatcctggcatctggccgacagcccc
I3MUP5_BCL2L1-02        cccccagtgccatcaatggcaacccatcctggcatctggccgacagcccc
I3ND50_BCL2L2-01        -----------------------------------ctggcc---------
I3ND50_BCL2L2-02        -----------------------------------ctggcc---------
                                                           *   *          

I3MCZ7_BCL2A1-01        --------------------------------------------------
I3MVK9_BCL2-01          acccc-------------------ggccgccagga---------------
A0A287DCH9_MCL1-01      gcccttgctggagctcgttggagaggccgccaagagtcccggcgcggacg
A0A287DCH9_MCL1-02      gcccttgctggagctcgttggagaggccgccaagagtcccggcgcggacg
A0A287CZ07_BCL2L1-      gcgataaatggagcc-----------------------------------
I3MUP5_BCL2L1-03        gcggtaaatggagcc-----------------------------------
I3MUP5_BCL2L1-01        gcggtaaatggagcc-----------------------------------
I3MUP5_BCL2L1-02        gcggtaaatggagcc-----------------------------------
I3ND50_BCL2L2-01        --------------------------------------------------
I3ND50_BCL2L2-02        --------------------------------------------------

I3MCZ7_BCL2A1-01        ----------caaagtgttacaaaacgtg-----------------gctt
I3MVK9_BCL2-01          ---------cctcgccaccgccacccccg-----------------gctg
A0A287DCH9_MCL1-01      ggtcgctgccctcgacgccgccgcccgcggaggaggaggacgacgagctg
A0A287DCH9_MCL1-02      ggtcgctgccctcgacgccgccgcccgcggaggaggaggacgacgagctg
A0A287CZ07_BCL2L1-      ---------actggtcacagcagcagttt-----------------ggat
I3MUP5_BCL2L1-03        ---------actggtcacagcagcagttt-----------------ggat
I3MUP5_BCL2L1-01        ---------actggtcacagcagcagttt-----------------ggat
I3MUP5_BCL2L1-02        ---------actggtcacagcagcagttt-----------------ggat
I3ND50_BCL2L2-01        ----------ctgg--------------g-----------------gagg
I3ND50_BCL2L2-02        ----------ctgg--------------g-----------------gagg
                                  *                                   *   

I3MCZ7_BCL2A1-01        tctcagt-------------------------------------------
I3MVK9_BCL2-01          cccccgctgccgc-------------------------------------
A0A287DCH9_MCL1-01      taccggcagtcgctggagatcatttcgcggtacctccgcgagcaggcgac
A0A287DCH9_MCL1-02      taccggcagtcgctggagatcatttcgcggtacctccgcgagcaggcgac
A0A287CZ07_BCL2L1-      gcccgggaggtga-------------------------------------
I3MUP5_BCL2L1-03        gcccgggaggtga-------------------------------------
I3MUP5_BCL2L1-01        gcccgggaggtga-------------------------------------
I3MUP5_BCL2L1-02        gcccgggaggtga-------------------------------------
I3ND50_BCL2L2-01        gcccagcagctga-------------------------------------
I3ND50_BCL2L2-02        gcccagcagctga-------------------------------------
                           * *                                            

I3MCZ7_BCL2A1-01        ------------------------------------------ccaaaaag
I3MVK9_BCL2-01          ------------cgcggggcccgtgc-tcagcccggtgccacctgt----
A0A287DCH9_MCL1-01      cggctccaaggacgcgaagccgctgcgtgggtcgggggccgccagcagga
A0A287DCH9_MCL1-02      cggctccaaggacgcgaagccgctgcgtgggtcgggggccgccagcagga
A0A287CZ07_BCL2L1-      --------------------------------------tccccatggcag
I3MUP5_BCL2L1-03        --------------------------------------tccccatggcag
I3MUP5_BCL2L1-01        --------------------------------------tccccatggcag
I3MUP5_BCL2L1-02        --------------------------------------tccccatggcag
I3ND50_BCL2L2-01        --------------------------------------tccac-------
I3ND50_BCL2L2-02        --------------------------------------tccac-------

I3MCZ7_BCL2A1-01        aagttgaaaagaatctgaaaccattcttggacaattt-------------
I3MVK9_BCL2-01          -ggtccacctgaccctccgccaggccggcgatgacttctctcgtcgctat
A0A287DCH9_MCL1-01      aggcgctggagaccctgcggcgggtcggcgacggagtgcagcgcaacca-
A0A287DCH9_MCL1-02      aggcgctggagaccctgcggcgggtcggcgacggagtgcagcgcaacca-
A0A287CZ07_BCL2L1-      cagtgaagcaagcattgagggaggcaggcgacgagtttgaactgtggtac
I3MUP5_BCL2L1-03        cagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtac
I3MUP5_BCL2L1-01        cagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtac
I3MUP5_BCL2L1-02        cagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtac
I3ND50_BCL2L2-01        ---tgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
I3ND50_BCL2L2-02        ---tgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
                                       *             **     *             

I3MCZ7_BCL2A1-01        --------------tgatgtggtgt--------ctgc---tgatactg--
I3MVK9_BCL2-01          cgtcgcgacttcgccgagatgtccagtcag---ctgcacctgacgccct-
A0A287DCH9_MCL1-01      --------------cgagacggccttccaaggcatgcttcggaagctgg-
A0A287DCH9_MCL1-02      --------------cgagacggccttccaaggcatgcttcggaagctgg-
A0A287CZ07_BCL2L1-      tggcgggcattcagtgacctgacgtcccag---ctccacatcaccctggg
I3MUP5_BCL2L1-03        cggcgggcattcagtgacctgacgtcccag---ctccacatcaccccggg
I3MUP5_BCL2L1-01        cggcgggcattcagtgacctgacgtcccag---ctccacatcaccccggg
I3MUP5_BCL2L1-02        cggcgggcattcagtgacctgacgtcccag---ctccacatcaccccggg
I3ND50_BCL2L2-01        cggcgcaccttctctgatctggcagctcag---ctgcatgtgaccccggg
I3ND50_BCL2L2-02        cggcgcaccttctctgatctggcagctcag---ctgcatgtgaccccggg
                                       **   *             * *     *  *    

I3MCZ7_BCL2A1-01        -ccagaacaat-----------------attcaatcaa-gtgatggaaaa
I3MVK9_BCL2-01          -tcaccgcaa--ggggacg---------ctttgccacg-gtggtggagga
A0A287DCH9_MCL1-01      -acatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtcca
A0A287DCH9_MCL1-02      -acatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtcca
A0A287CZ07_BCL2L1-      gacagcatatcagag-------------ctttgaacag-gtagtgaacga
I3MUP5_BCL2L1-03        gacagcatatcagag-------------ctttgaacag-gtagtgaacga
I3MUP5_BCL2L1-01        gacagcatatcagag-------------ctttgaacag-gtagtgaacga
I3MUP5_BCL2L1-02        gacagcatatcagag-------------ctttgaacag-gtagtgaacga
I3ND50_BCL2L2-01        ttcagctcagcaacg-------------cttcacccag-gtctctgacga
I3ND50_BCL2L2-02        ttcagctcagcaacg-------------cttcacccag-gtctctgacga
                          **    *                    *         **        *

I3MCZ7_BCL2A1-01        ggaatttgaagatggcatcatgaactggggaaggattgtgaccatatttg
I3MVK9_BCL2-01          gctcttcagggatggggt---gaactgggggaggattgtggccttctttg
A0A287DCH9_MCL1-01      tgttttcagtgacggagtaacaaactggggcaggattgtgactctcattt
A0A287DCH9_MCL1-02      tgttttcagtgacggagtaacaaactggggcaggattgtgactctcattt
A0A287CZ07_BCL2L1-      actcttccgggatggggt---aaactggggtcacattgtggcctttctct
I3MUP5_BCL2L1-03        actcttccgggatggggt---aaactggggtcgcattgtggcctttttct
I3MUP5_BCL2L1-01        actcttccgggatggggt---aaactggggtcgcattgtggcctttttct
I3MUP5_BCL2L1-02        actcttccgggatggggt---aaactggggtcgcattgtggcctttttct
I3ND50_BCL2L2-01        acttttccaagggggtcc---caactggggtcgtcttgtggccttctttg
I3ND50_BCL2L2-02        acttttccaagggggtcc---caactggggtcgtcttgtggccttctttg
                            **    *  **       ********     ***** *  *  *  

I3MCZ7_BCL2A1-01        ccttcgg------aggagttctg---gtcaagaaacttctgcgagagcgg
I3MVK9_BCL2-01          agttcgg------tggggtcatgtgtgtggaga-------gcgtcaaccg
A0A287DCH9_MCL1-01      cttttggtgcctttgtggccaaacacttgaaga-------gcataaacca
A0A287DCH9_MCL1-02      cttttggtgcctttgtggccaaacacttgaaga-------gcataaacca
A0A287CZ07_BCL2L1-      cctttgg------cggggcactgtgcatggaaa-------gcgtagacaa
I3MUP5_BCL2L1-03        ccttcgg------cggggcactgtgcgtggaaa-------gcgtagacaa
I3MUP5_BCL2L1-01        ccttcgg------cggggcactgtgcgtggaaa-------gcgtagacaa
I3MUP5_BCL2L1-02        ccttcgg------cggggcactgtgcgtggaaa-------gcgtagacaa
I3ND50_BCL2L2-01        tctttgg------ggctgccctgtgtgctgaga-------gtgtcaacaa
I3ND50_BCL2L2-02        tctttgg------ggctgccctgtgtgctgaga-------gtgtcaacaa
                          ** **       *  *            * *       *      *  

I3MCZ7_BCL2A1-01        attgcccctgctgtggattccgatgaggag-atctcttactttgtggctg
I3MVK9_BCL2-01          ggag------atgtcgcccctggtggacaacatcgc--------------
A0A287DCH9_MCL1-01      agaaagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaa
A0A287DCH9_MCL1-02      agaaagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaa
A0A287CZ07_BCL2L1-      ggag------atgcaggtattggtgagtcggatcgcaagttggat-----
I3MUP5_BCL2L1-03        ggag------atgcaggtattggtgagtcggatcgcaagttggatggcca
I3MUP5_BCL2L1-01        ggag------atgcaggtattggtgagtcggatcgcaagttggatggcca
I3MUP5_BCL2L1-02        ggag------atgcaggtattggtgagtcggatcgcaagttggatggcca
I3ND50_BCL2L2-01        agag------atggagccactggtgggacaagtgcaggagtggatggtgg
I3ND50_BCL2L2-02        agag------atggagccactggtgggacaagtgcaggagtggatggtgg
                                   *                    *                 

I3MCZ7_BCL2A1-01        agttcattatgaataatgcaggagaatggataaggcaaaatggaggctgg
I3MVK9_BCL2-01          --------------------------------------------------
A0A287DCH9_MCL1-01      ggacaaaacgggactggctggt------------caaacaaagaggctgg
A0A287DCH9_MCL1-02      ggacaaaacgggactggctggt------------caaacaaagaggctgg
A0A287CZ07_BCL2L1-      ----------------------gccttggatccaagagaacggcggctgg
I3MUP5_BCL2L1-03        cttacctgaatgaccacctagagccttggatccaggagaacggcggctgg
I3MUP5_BCL2L1-01        cttacctgaatgaccacctagagccttggatccaggagaacggcggctgg
I3MUP5_BCL2L1-02        cttacctgaatgaccacctagagccttggatccaggagaacggcggctgg
I3ND50_BCL2L2-01        cctacctggagacgcggctggctgactggatccacagcagtgggggctgg
I3ND50_BCL2L2-02        cctacctggagacgcggctggctgactggatccacagcagtgggggctgg

I3MCZ7_BCL2A1-01        gaaa-----atggctttgtaaagaagt-----------ttgaacctaaa-
I3MVK9_BCL2-01          ------cctgtggatgact-------------------gagtacctgaac
A0A287DCH9_MCL1-01      gatgggtttgtggagttcttccatgta-----------gaggacctagaa
A0A287DCH9_MCL1-02      gatgggtttgtggagttcttccatgta-----------gaggacctagaa
A0A287CZ07_BCL2L1-      gacacttttgtggaactctacaggaataatgcggcagcagagagccggaa
I3MUP5_BCL2L1-03        gacacttttgtggaactctacgggaataatgcagcagcagagagccggaa
I3MUP5_BCL2L1-01        gacacttttgtggaactctacgggaataatgcagcagcagagagccggaa
I3MUP5_BCL2L1-02        gacacttttgtggaactctacgggaataatgcagcagcagagagccggaa
I3ND50_BCL2L2-01        gcggagttcacagctctatacggggac-----------ggggccctggag
I3ND50_BCL2L2-02        ----------ctgttctccagggggaatatg-------ggggctctga--
                                    *                               *     

I3MCZ7_BCL2A1-01        --------------tctggctggttgacttttctgggagt----------
I3MVK9_BCL2-01          --cggcacc-----tgca-cacctggatccag------------------
A0A287DCH9_MCL1-01      ggcggcatcagaaatgtg-ctgctggctttcgcaggtgtt----------
A0A287DCH9_MCL1-02      ggcggcatcagaaatgtg-ctgctggctttcgcaggtgtt----------
A0A287CZ07_BCL2L1-      -gggccaggagcgcttcaaccgttggttcctgacgggcatgactgtg---
I3MUP5_BCL2L1-03        -gggccaggagcgcttcaaccgttggttcctgacgggcatgactgtg---
I3MUP5_BCL2L1-01        -gggccaggagcgcttcaaccgttggttcctgacgggcatgactgtg---
I3MUP5_BCL2L1-02        -gggccaggagcgcttcaaccgttggttcctgacgggcatgactgtg---
I3ND50_BCL2L2-01        -gaggcacggcgtctgcgggagggg-----aactgggcatcagtgaggac
I3ND50_BCL2L2-02        ------ttggaggctgggacagctg-----tgctgggaa-----------

I3MCZ7_BCL2A1-01        ----------tacagggcaga-tctgtgagatgctgtctctcctgaagca
I3MVK9_BCL2-01          ----------gataacggag--gctgg--------------gtaggtgca
A0A287DCH9_MCL1-01      ----------gctggcgtaggagctgg--------------tttg--gca
A0A287DCH9_MCL1-02      ----------gctggcgtaggagctgg--------------tttg--gca
A0A287CZ07_BCL2L1-      ----------gccggtgtggt-tctgc---------------tgggctca
I3MUP5_BCL2L1-03        ----------gccggcgtggt-tctgc---------------tgggctcg
I3MUP5_BCL2L1-01        ----------gccggcgtggt-tctgc---------------tgggctcg
I3MUP5_BCL2L1-02        ----------gccggcgtggt-tctgc---------------tgggctcg
I3ND50_BCL2L2-01        agtgctgacgggggccgtggc-actgggggccctggtaactgtaggggcc
I3ND50_BCL2L2-02        ----------ggaggcatggg-gctga-----------------------
                                           *   ***                        

I3MCZ7_BCL2A1-01        atact--------attga
I3MVK9_BCL2-01          cgtcgggtt---gaatga
A0A287DCH9_MCL1-01      tatctaata---agatag
A0A287DCH9_MCL1-02      tatctaata---agatag
A0A287CZ07_BCL2L1-      cttttcagtcggaaatga
I3MUP5_BCL2L1-03        cttttcagtcggaaatga
I3MUP5_BCL2L1-01        cttttcagtcggaaatga
I3MUP5_BCL2L1-02        cttttcagtcggaaatga
I3ND50_BCL2L2-01        ttttttgctagcaagtga
I3ND50_BCL2L2-02        ------------------

© 1998-2019