Dataset for CDS BCL2L2 of organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I3ND50_BCL2L2-01      atggcgaccccagcctcggccccagacacacgggctctggtggccgactt
I3ND50_BCL2L2-02      atggcgaccccagcctcggccccagacacacgggctctggtggccgactt
                      **************************************************

I3ND50_BCL2L2-01      tgtaggctataagctgaggcagaagggttacgtctgtggagctggccctg
I3ND50_BCL2L2-02      tgtaggctataagctgaggcagaagggttacgtctgtggagctggccctg
                      **************************************************

I3ND50_BCL2L2-01      gggagggcccagcagctgatccactgcaccaagccatgcgggcagctgga
I3ND50_BCL2L2-02      gggagggcccagcagctgatccactgcaccaagccatgcgggcagctgga
                      **************************************************

I3ND50_BCL2L2-01      gatgagttcgagacccgcttccggcgcaccttctctgatctggcagctca
I3ND50_BCL2L2-02      gatgagttcgagacccgcttccggcgcaccttctctgatctggcagctca
                      **************************************************

I3ND50_BCL2L2-01      gctgcatgtgaccccgggttcagctcagcaacgcttcacccaggtctctg
I3ND50_BCL2L2-02      gctgcatgtgaccccgggttcagctcagcaacgcttcacccaggtctctg
                      **************************************************

I3ND50_BCL2L2-01      acgaacttttccaagggggtcccaactggggtcgtcttgtggccttcttt
I3ND50_BCL2L2-02      acgaacttttccaagggggtcccaactggggtcgtcttgtggccttcttt
                      **************************************************

I3ND50_BCL2L2-01      gtctttggggctgccctgtgtgctgagagtgtcaacaaagagatggagcc
I3ND50_BCL2L2-02      gtctttggggctgccctgtgtgctgagagtgtcaacaaagagatggagcc
                      **************************************************

I3ND50_BCL2L2-01      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
I3ND50_BCL2L2-02      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
                      **************************************************

I3ND50_BCL2L2-01      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta
I3ND50_BCL2L2-02      tggctgactggatccacagcagtgggggctgg----------ctgttctc
                      ********************************          * * *** 

I3ND50_BCL2L2-01      tacggggac----ggggccctggaggaggcacggcgtctgcgggagggga
I3ND50_BCL2L2-02      cagggggaatatgggggctctga-------ttggaggctgggacagctgt
                       * *****     ***** ***          ** * *** *  **  * 

I3ND50_BCL2L2-01      actgggcatcagtgaggacagtgctgacgggggccgtggcactgggggcc
I3ND50_BCL2L2-02      gctgggaa---------------------ggaggcatggggctga-----
                       ***** *                     ** * * ***  ***      

I3ND50_BCL2L2-01      ctggtaactgtaggggccttttttgctagcaagtga
I3ND50_BCL2L2-02      ------------------------------------
                                                          

© 1998-2018