Dataset for CDS MCL-1 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


C8YZ26_MCL1-01          atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A087WT64_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
B4E3L8_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A087WT64_MCL1-04      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
B4DLY8_MCL1-01          atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A087WT64_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
B4DG83_MCL1-01          --------------------------------------------------
                                                                          

C8YZ26_MCL1-01          gggggccggcttgggggccggcagcggcggcgccacccgcccgggagggc
A0A087WT64_MCL1-03      gggggccggcttgggggccggcagcggcggcgccacccgcccgggagggc
B4E3L8_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          gggggccggcttgggggccggcagcggcggcgccacccgcccgggagggc
A0A087WT64_MCL1-04      gggggccggcttgggggccggcagcggcggcgccacccgcccgggagggc
B4DLY8_MCL1-01          gggggccggcttgggggccggcagcggcggcgccacccgcccgggagggc
A0A087WT64_MCL1-01      gggggccggcttgggggccggcagcggcggcgccacccgcccgggagggc
B4DG83_MCL1-01          --------------------------------------------------
                                                                          

C8YZ26_MCL1-01          gacttttg------------------------------------------
A0A087WT64_MCL1-03      gacttttggctacggagaaggaggcctcggcccggcgagagataggggga
B4E3L8_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          gacttttggctacggag---------------------------------
A0A087WT64_MCL1-04      gacttttg------------------------------------------
B4DLY8_MCL1-01          gacttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A087WT64_MCL1-01      gacttttggctacggagaaggaggcctcggcccggcgagagataggggga
B4DG83_MCL1-01          --------------------------------------------------
                                                                          

C8YZ26_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-03      ggggaggccggcgcggtgattggcggaagcgccggcgcaagccccccgtc
B4E3L8_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-04      --------------------------------------------------
B4DLY8_MCL1-01          ggggaggccggcgcggtgattggcggaagcgccggcgcaagccccccgtc
A0A087WT64_MCL1-01      ggggaggccggcgcggtgattggcggaagcgccggcgcaagccccccgtc
B4DG83_MCL1-01          --------------------------------------------------
                                                                          

C8YZ26_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-03      caccctcacgccagactcccggagggtcgcgcggccgccgcccattggcg
B4E3L8_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-04      --------------------------------------------------
B4DLY8_MCL1-01          caccctcacgccagactcccggagg-------------------------
A0A087WT64_MCL1-01      caccctcacgccagactcccggagggtcgcgcggccgccgcccattggcg
B4DG83_MCL1-01          --------------------------------------------------
                                                                          

C8YZ26_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-03      ccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcg
B4E3L8_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-04      --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-01      ccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcg
B4DG83_MCL1-01          --------------------------------------------------
                                                                          

C8YZ26_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-03      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgctga
B4E3L8_MCL1-01          ------------------------------atggaagccccggccgctga
B4DU51_MCL1-01          ------------------------------atggaagccccggccgctga
A0A087WT64_MCL1-04      --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-01      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgctga
B4DG83_MCL1-01          ------------------------------atggaagccccggccgctga
                                                                          

C8YZ26_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-03      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
B4E3L8_MCL1-01          cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
B4DU51_MCL1-01          cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A087WT64_MCL1-04      --------------------------------------------------
B4DLY8_MCL1-01          ---------gtcgcgcg---------------------------------
A0A087WT64_MCL1-01      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
B4DG83_MCL1-01          cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
                                                                          

C8YZ26_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-03      tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatct
B4E3L8_MCL1-01          tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatct
B4DU51_MCL1-01          tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatct
A0A087WT64_MCL1-04      --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-01      tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatct
B4DG83_MCL1-01          tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatct
                                                                          

C8YZ26_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-03      ggtaataacaccagtacggacgggtcactaccctcgacgccgccgccagc
B4E3L8_MCL1-01          ggtaataacaccagtacggacgggtcactaccctcgacgccgccgccagc
B4DU51_MCL1-01          ggtaataacaccagtacggacgggtcactacccttgacgccgccgccagc
A0A087WT64_MCL1-04      --------------------------------------gccaccg-----
B4DLY8_MCL1-01          --------------------------------------gccgccgc----
A0A087WT64_MCL1-01      ggtaataacaccagtacggacgggtcactaccctcgacgccgccgccagc
B4DG83_MCL1-01          ggtaataacaccagtacggacgggtcactaccctcgacgccgccgccagc
                                                                          

C8YZ26_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-03      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
B4E3L8_MCL1-01          agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
B4DU51_MCL1-01          agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
A0A087WT64_MCL1-04      --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-01      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
B4DG83_MCL1-01          agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
                                                                          

C8YZ26_MCL1-01          -----------------gccaccggcgccaaggacacaaagccaatgggc
A0A087WT64_MCL1-03      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
B4E3L8_MCL1-01          ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
B4DU51_MCL1-01          ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
A0A087WT64_MCL1-04      ------------------------gcgccaaggacacaaagccaatgggc
B4DLY8_MCL1-01          ---------------------------ccaaggacacaaagccaatgggc
A0A087WT64_MCL1-01      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
B4DG83_MCL1-01          ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
                                                   ***********************

C8YZ26_MCL1-01          aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
A0A087WT64_MCL1-03      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
B4E3L8_MCL1-01          aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
B4DU51_MCL1-01          aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
A0A087WT64_MCL1-04      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
B4DLY8_MCL1-01          aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
A0A087WT64_MCL1-01      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
B4DG83_MCL1-01          aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
                        **************************************************

C8YZ26_MCL1-01          ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A087WT64_MCL1-03      ggatggcgtgcagcgcaaccacgagacggccttccaa-------------
B4E3L8_MCL1-01          ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
B4DU51_MCL1-01          ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A087WT64_MCL1-04      ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
B4DLY8_MCL1-01          ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A087WT64_MCL1-01      ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
B4DG83_MCL1-01          ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
                        *************************************             

C8YZ26_MCL1-01          gactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatg
A0A087WT64_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          aactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatg
B4DU51_MCL1-01          aactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatg
A0A087WT64_MCL1-04      aactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatg
B4DLY8_MCL1-01          aactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatg
A0A087WT64_MCL1-01      aactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatg
B4DG83_MCL1-01          aactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatg
                                                                          

C8YZ26_MCL1-01          atccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
A0A087WT64_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          atccatgttttcagcgacagcgtaacaaactggggcaggattgtgactct
B4DU51_MCL1-01          atccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
A0A087WT64_MCL1-04      atccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
B4DLY8_MCL1-01          atccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
A0A087WT64_MCL1-01      atccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
B4DG83_MCL1-01          atccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
                                                                          

C8YZ26_MCL1-01          catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
A0A087WT64_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
B4DU51_MCL1-01          catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
A0A087WT64_MCL1-04      catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
B4DLY8_MCL1-01          catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
A0A087WT64_MCL1-01      catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
B4DG83_MCL1-01          catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
                                                                          

C8YZ26_MCL1-01          aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A087WT64_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
B4DU51_MCL1-01          aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A087WT64_MCL1-04      aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
B4DLY8_MCL1-01          aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A087WT64_MCL1-01      aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
B4DG83_MCL1-01          aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
                                                                          

C8YZ26_MCL1-01          acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
A0A087WT64_MCL1-03      -----------------------------------ggatgggtttgtgga
B4E3L8_MCL1-01          acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
B4DU51_MCL1-01          acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
A0A087WT64_MCL1-04      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
B4DLY8_MCL1-01          acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
A0A087WT64_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
B4DG83_MCL1-01          acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
                                                           ***************

C8YZ26_MCL1-01          gttcttccaagtagaggacctagaaggtggcatcaggaatgtgctgctgg
A0A087WT64_MCL1-03      gttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctgg
B4E3L8_MCL1-01          gttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctgg
B4DU51_MCL1-01          gttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctgg
A0A087WT64_MCL1-04      gttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctgg
B4DLY8_MCL1-01          gttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctgg
A0A087WT64_MCL1-01      gttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctgg
B4DG83_MCL1-01          gttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctgg
                        ********* ****************************************

C8YZ26_MCL1-01          cttttgcaggtgttgctggagtaggagctggtttggcatatctaaaaaga
A0A087WT64_MCL1-03      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
B4E3L8_MCL1-01          cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
B4DU51_MCL1-01          cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A087WT64_MCL1-04      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
B4DLY8_MCL1-01          cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A087WT64_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
B4DG83_MCL1-01          cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
                        ********************************************* ****

C8YZ26_MCL1-01          tag-----------
A0A087WT64_MCL1-03      tagccttactgtaa
B4E3L8_MCL1-01          tag-----------
B4DU51_MCL1-01          tag-----------
A0A087WT64_MCL1-04      tag-----------
B4DLY8_MCL1-01          tag-----------
A0A087WT64_MCL1-01      tag-----------
B4DG83_MCL1-01          tag-----------
                        ***           

© 1998-2018