Dataset for CDS BCL-2-like of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

21 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


B4E1X9_BCL2A1-01       atgac---------------------------------------------
Q16548_BCL2A1-02       atgac---------------------------------------------
Q16548_BCL2A1-01       atgac---------------------------------------------
Q07817_BCL2L1-03       atgt----------------------------------------ctcaga
Q07817_BCL2L1-01       atgt----------------------------------------ctcaga
Q07817_BCL2L1-02       atgt----------------------------------------ctcaga
P10415_BCL2-04         atggcg------------------------------------cacgctgg
A9QXG9_BCL2-01         atggcg------------------------------------cacgctgg
P10415_BCL2-01         atggcg------------------------------------cacgctgg
P10415_BCL2-02         atggcg------------------------------------cacgctgg
Q92843_BCL2L2-02       atggcgaccc-------------------------cagcctcggccccag
Q9HD36_BCL2L10-01      atggttgacc-------agttgcgggagc---------gcaccaccatgg
Q9HD36_BCL2L10-02      atggttgacc-------agttgcgggagc---------gcaccaccatgg
C8YZ26_MCL1-01         atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
Q07820_MCL1-03         atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
B4DU51_MCL1-01         atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
Q07820_MCL1-04         atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
B4E3L8_MCL1-01         --------------------------------------------------
B4DLY8_MCL1-01         atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
Q07820_MCL1-01         atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
B4DG83_MCL1-01         --------------------------------------------------
                                                                         

B4E1X9_BCL2A1-01       -----------------------agactgtgaatttggatatat-ttaca
Q16548_BCL2A1-02       -----------------------agactgtgaatttggatatat-ttaca
Q16548_BCL2A1-01       -----------------------agactgtgaatttggatatat-ttaca
Q07817_BCL2L1-03       gcaaccgggagctggtggt----tgacttt----------ctctcctaca
Q07817_BCL2L1-01       gcaaccgggagctggtggt----tgacttt----------ctctcctaca
Q07817_BCL2L1-02       gcaaccgggagctggtggt----tgacttt----------ctctcctaca
P10415_BCL2-04         gagaacagggtacgataaccgggagatagtgatgaagtacatccattata
A9QXG9_BCL2-01         gagaacggggtacgataaccgggagatagtgatgaagtacatccattata
P10415_BCL2-01         gagaacagggtacgataaccgggagatagtgatgaagtacatccattata
P10415_BCL2-02         gagaacagggtacgataaccgggagatagtgatgaagtacatccattata
Q92843_BCL2L2-02       acacacgggctctggtggc----agactttgtag--g--------ttata
Q9HD36_BCL2L10-01      ccgacccgctgc-gggagc----gcaccgagctgttg--------ctggc
Q9HD36_BCL2L10-02      ccgacccgctgc-gggagc----gcaccgagctgttg--------ctggc
C8YZ26_MCL1-01         gggggccggctt-gggggc----cggcagcggcggcg--------ccacc
Q07820_MCL1-03         gggggccggctt-gggggc----cggcagcggcggcg--------ccacc
B4DU51_MCL1-01         gggggccggctt-gggggc----cggcagcggcggcg--------ccacc
Q07820_MCL1-04         gggggccggctt-gggggc----cggcagcggcggcg--------ccacc
B4E3L8_MCL1-01         --------------------------------------------------
B4DLY8_MCL1-01         gggggccggctt-gggggc----cggcagcggcggcg--------ccacc
Q07820_MCL1-01         gggggccggctt-gggggc----cggcagcggcggcg--------ccacc
B4DG83_MCL1-01         --------------------------------------------------
                                                                         

B4E1X9_BCL2A1-01       ggctggctcaggactat---------------------------------
Q16548_BCL2A1-02       ggctggctcaggactat---------------------------------
Q16548_BCL2A1-01       ggctggctcaggactat---------------------------------
Q07817_BCL2L1-03       agctttcccagaaaggatacagctggag----------------------
Q07817_BCL2L1-01       agctttcccagaaaggatacagctggag----------------------
Q07817_BCL2L1-02       agctttcccagaaaggatacagctggag----------------------
P10415_BCL2-04         agctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgcc---
A9QXG9_BCL2-01         agctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgcc---
P10415_BCL2-01         agctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgcc---
P10415_BCL2-02         agctgtcgcagaggggctacgagtgggatgcgggagatgtgggcgcc---
Q92843_BCL2L2-02       agctgaggcagaagggttatgtctgtggagc-------------------
Q9HD36_BCL2L10-01      cgactacctggggtact---------------------------------
Q9HD36_BCL2L10-02      cgactacctggggtact---------------------------------
C8YZ26_MCL1-01         cgcccgggagggcgactttt------------------------------
Q07820_MCL1-03         cgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcg
B4DU51_MCL1-01         cgcccgggagggcgacttttggctacggag--------------------
Q07820_MCL1-04         cgcccgggagggcgactttt------------------------------
B4E3L8_MCL1-01         --------------------------------------------------
B4DLY8_MCL1-01         cgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcg
Q07820_MCL1-01         cgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcg
B4DG83_MCL1-01         --------------------------------------------------
                                                                         

B4E1X9_BCL2A1-01       --------------------------------------------------
Q16548_BCL2A1-02       --------------------------------------------------
Q16548_BCL2A1-01       --------------------------------------------------
Q07817_BCL2L1-03       --------------------------------------------------
Q07817_BCL2L1-01       --------------------------------------------------
Q07817_BCL2L1-02       --------------------------------------------------
P10415_BCL2-04         --------------------------------------------------
A9QXG9_BCL2-01         --------------------------------------------------
P10415_BCL2-01         --------------------------------------------------
P10415_BCL2-02         --------------------------------------------------
Q92843_BCL2L2-02       --------------------------------------------------
Q9HD36_BCL2L10-01      --------------------------------------------------
Q9HD36_BCL2L10-02      --------------------------------------------------
C8YZ26_MCL1-01         --------------------------------------------------
Q07820_MCL1-03         agagatagggggaggggaggccggcgcggtgattggcggaagcgccggcg
B4DU51_MCL1-01         --------------------------------------------------
Q07820_MCL1-04         --------------------------------------------------
B4E3L8_MCL1-01         --------------------------------------------------
B4DLY8_MCL1-01         agagatagggggaggggaggccggcgcggtgattggcggaagcgccggcg
Q07820_MCL1-01         agagatagggggaggggaggccggcgcggtgattggcggaagcgccggcg
B4DG83_MCL1-01         --------------------------------------------------
                                                                         

B4E1X9_BCL2A1-01       --------------------------------------------------
Q16548_BCL2A1-02       --------------------------------------------------
Q16548_BCL2A1-01       --------------------------------------------------
Q07817_BCL2L1-03       --------------------------------------------------
Q07817_BCL2L1-01       --------------------------------------------------
Q07817_BCL2L1-02       --------------------------------------------------
P10415_BCL2-04         --------------------------------------------------
A9QXG9_BCL2-01         --------------------------------------------------
P10415_BCL2-01         --------------------------------------------------
P10415_BCL2-02         --------------------------------------------------
Q92843_BCL2L2-02       --------------------------------------------------
Q9HD36_BCL2L10-01      --------------------------------------------------
Q9HD36_BCL2L10-02      --------------------------------------------------
C8YZ26_MCL1-01         --------------------------------------------------
Q07820_MCL1-03         caagccccccgtccaccctcacgccagactcccggagggtcgcgcggccg
B4DU51_MCL1-01         --------------------------------------------------
Q07820_MCL1-04         --------------------------------------------------
B4E3L8_MCL1-01         --------------------------------------------------
B4DLY8_MCL1-01         caagccccccgtccaccctcacgccagactcccggagg------------
Q07820_MCL1-01         caagccccccgtccaccctcacgccagactcccggagggtcgcgcggccg
B4DG83_MCL1-01         --------------------------------------------------
                                                                         

B4E1X9_BCL2A1-01       --------------------------------------------------
Q16548_BCL2A1-02       --------------------------------------------------
Q16548_BCL2A1-01       --------------------------------------------------
Q07817_BCL2L1-03       --------------------------------------------------
Q07817_BCL2L1-01       --------------------------------------------------
Q07817_BCL2L1-02       --------------------------------------------------
P10415_BCL2-04         --------------------------------------------------
A9QXG9_BCL2-01         --------------------------------------------------
P10415_BCL2-01         --------------------------------------------------
P10415_BCL2-02         --------------------------------------------------
Q92843_BCL2L2-02       --------------------------------------------------
Q9HD36_BCL2L10-01      --------------------------------------------------
Q9HD36_BCL2L10-02      --------------------------------------------------
C8YZ26_MCL1-01         --------------------------------------------------
Q07820_MCL1-03         ccgcccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggct
B4DU51_MCL1-01         --------------------------------------------------
Q07820_MCL1-04         --------------------------------------------------
B4E3L8_MCL1-01         --------------------------------------------------
B4DLY8_MCL1-01         --------------------------------------------------
Q07820_MCL1-01         ccgcccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggct
B4DG83_MCL1-01         --------------------------------------------------
                                                                         

B4E1X9_BCL2A1-01       --------------------------------------------------
Q16548_BCL2A1-02       --------------------------------------------------
Q16548_BCL2A1-01       --------------------------------------------------
Q07817_BCL2L1-03       --------------------------------------------------
Q07817_BCL2L1-01       --------------------------------------------------
Q07817_BCL2L1-02       --------------------------------------------------
P10415_BCL2-04         --------------------------------------------------
A9QXG9_BCL2-01         --------------------------------------------------
P10415_BCL2-01         --------------------------------------------------
P10415_BCL2-02         --------------------------------------------------
Q92843_BCL2L2-02       --------------------------------------------------
Q9HD36_BCL2L10-01      --------------------------------------------------
Q9HD36_BCL2L10-02      --------------------------------------------------
C8YZ26_MCL1-01         --------------------------------------------------
Q07820_MCL1-03         gcttttcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaag
B4DU51_MCL1-01         -------------------------------------------atggaag
Q07820_MCL1-04         --------------------------------------------------
B4E3L8_MCL1-01         -------------------------------------------atggaag
B4DLY8_MCL1-01         --------------------------------------------------
Q07820_MCL1-01         gcttttcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaag
B4DG83_MCL1-01         -------------------------------------------atggaag
                                                                         

B4E1X9_BCL2A1-01       --------------------------------------------------
Q16548_BCL2A1-02       --------------------------------------------------
Q16548_BCL2A1-01       --------------------------------------------------
Q07817_BCL2L1-03       -----------------------tcagtttagtgatgtggaagagaacag
Q07817_BCL2L1-01       -----------------------tcagtttagtgatgtggaagagaacag
Q07817_BCL2L1-02       -----------------------tcagtttagtgatgtggaagagaacag
P10415_BCL2-04         -----------------------gcgcccccgggggccgcccccgcaccg
A9QXG9_BCL2-01         -----------------------gcgcccccgggggccgcccccgcaccg
P10415_BCL2-01         -----------------------gcgcccccgggggccgcccccgcaccg
P10415_BCL2-02         -----------------------gcgcccccgggggccgcccccgcaccg
Q92843_BCL2L2-02       -----------------------tggccccgggga---------gggccc
Q9HD36_BCL2L10-01      -----------------------gcgcccg----g---------gaaccc
Q9HD36_BCL2L10-02      -----------------------gcgcccg----g---------gaaccc
C8YZ26_MCL1-01         --------------------------------------------------
Q07820_MCL1-03         ccccggccgctgacgccatcatgtcgcccgaagag---------gagctg
B4DU51_MCL1-01         ccccggccgctgacgccatcatgtcgcccgaagag---------gagctg
Q07820_MCL1-04         --------------------------------------------------
B4E3L8_MCL1-01         ccccggccgctgacgccatcatgtcgcccgaagag---------gagctg
B4DLY8_MCL1-01         ----------------------gtcgcgcg--------------------
Q07820_MCL1-01         ccccggccgctgacgccatcatgtcgcccgaagag---------gagctg
B4DG83_MCL1-01         ccccggccgctgacgccatcatgtcgcccgaagag---------gagctg
                                                                         

B4E1X9_BCL2A1-01       -------------------------------------ctgcagtgcgtcc
Q16548_BCL2A1-02       -------------------------------------ctgcagtgcgtcc
Q16548_BCL2A1-01       -------------------------------------ctgcagtgcgtcc
Q07817_BCL2L1-03       gac--------------------tgaggccccagaagggactgaatcgga
Q07817_BCL2L1-01       gac--------------------tgaggccccagaagggactgaatcgga
Q07817_BCL2L1-02       gac--------------------tgaggccccagaagggactgaatcgga
P10415_BCL2-04         ggcatcttctcctcccagcccgggcacacgcc-----ccatccagccgca
A9QXG9_BCL2-01         ggcatcttctcctcccagcccgggcacacgcc-----ccatccagccgca
P10415_BCL2-01         ggcatcttctcctcccagcccgggcacacgcc-----ccatccagccgca
P10415_BCL2-02         ggcatcttctcctcccagcccgggcacacgcc-----ccatccagccgca
Q92843_BCL2L2-02       agcagct--gacccgctgcaccaagccatgcgggcagctg--gagatgag
Q9HD36_BCL2L10-01      ggcacccccgagccggcgccatcc---acgcccgaggccgccgtgctgcg
Q9HD36_BCL2L10-02      ggcacccccgagccggcgccatcc---acgcccgaggccgccgtgctgcg
C8YZ26_MCL1-01         --------------------------------------------------
Q07820_MCL1-03         gacgggtacgagccggagcctctcgggaagcggccggctgtcctgccgct
B4DU51_MCL1-01         gacgggtacgagccggagcctctcgggaagcggccggctgtcctgccgct
Q07820_MCL1-04         --------------------------------------------------
B4E3L8_MCL1-01         gacgggtacgagccggagcctctcgggaagcggccggctgtcctgccgct
B4DLY8_MCL1-01         --------------------------------------------------
Q07820_MCL1-01         gacgggtacgagccggagcctctcgggaagcggccggctgtcctgccgct
B4DG83_MCL1-01         gacgggtacgagccggagcctctcgggaagcggccggctgtcctgccgct
                                                                         

B4E1X9_BCL2A1-01       tacagataccacaa------------------------------------
Q16548_BCL2A1-02       tacagataccacaa------------------------------------
Q16548_BCL2A1-01       tacagataccacaa------------------------------------
Q07817_BCL2L1-03       gatggagacccccagt----------------------------gccatc
Q07817_BCL2L1-01       gatggagacccccagt----------------------------gccatc
Q07817_BCL2L1-02       gatggagacccccagt----------------------------gccatc
P10415_BCL2-04         tcccgggacccg-----------------------------------gtc
A9QXG9_BCL2-01         tcccgggacccg-----------------------------------gtc
P10415_BCL2-01         tcccgggacccg-----------------------------------gtc
P10415_BCL2-02         tcccgggacccg-----------------------------------gtc
Q92843_BCL2L2-02       ttcgagacccgc-----------------------ttccggcgcaccttc
Q9HD36_BCL2L10-01      ctccgcggccgccagg-------------------ttacggcaga--ttc
Q9HD36_BCL2L10-02      ctccgcggccgccagg-------------------ttacggcaga--ttc
C8YZ26_MCL1-01         --------------------------------------------------
Q07820_MCL1-03         gctggagttggtcggggaatctggtaataacaccagtacggacgg--gtc
B4DU51_MCL1-01         gctggagttggtcggggaatctggtaataacaccagtacggacgg--gtc
Q07820_MCL1-04         --------------------------------------------------
B4E3L8_MCL1-01         gctggagttggtcggggaatctggtaataacaccagtacggacgg--gtc
B4DLY8_MCL1-01         --------------------------------------------------
Q07820_MCL1-01         gctggagttggtcggggaatctggtaataacaccagtacggacgg--gtc
B4DG83_MCL1-01         gctggagttggtcggggaatctggtaataacaccagtacggacgg--gtc
                                                                         

B4E1X9_BCL2A1-01       --------------------------------------------------
Q16548_BCL2A1-02       --------------------------------------------------
Q16548_BCL2A1-01       --------------------------------------------------
Q07817_BCL2L1-03       aatggcaacccatcctggcacctggca-----------------------
Q07817_BCL2L1-01       aatggcaacccatcctggcacctggca-----------------------
Q07817_BCL2L1-02       aatggcaacccatcctggcacctggca-----------------------
P10415_BCL2-04         gccaggacctcgccgctgcag-----------------------------
A9QXG9_BCL2-01         gccaggacctcgccgctgcag-----------------------------
P10415_BCL2-01         gccaggacctcgccgctgcag-----------------------------
P10415_BCL2-02         gccaggacctcgccgctgcag-----------------------------
Q92843_BCL2L2-02       tctgatctggcggctcagctgcat--------------------------
Q9HD36_BCL2L10-01      accggtcctttttctccgcc------------------------------
Q9HD36_BCL2L10-02      accggtcctttttctccgcc------------------------------
C8YZ26_MCL1-01         --------------------------------------------------
Q07820_MCL1-03         acta--ccctcgacgccgccgccagcagaggaggaggaggacgagttgta
B4DU51_MCL1-01         acta--cccttgacgccgccgccagcagaggaggaggaggacgagttgta
Q07820_MCL1-04         --------------------------------------------------
B4E3L8_MCL1-01         acta--ccctcgacgccgccgccagcagaggaggaggaggacgagttgta
B4DLY8_MCL1-01         --------------gccgccgc----------------------------
Q07820_MCL1-01         acta--ccctcgacgccgccgccagcagaggaggaggaggacgagttgta
B4DG83_MCL1-01         acta--ccctcgacgccgccgccagcagaggaggaggaggacgagttgta
                                                                         

B4E1X9_BCL2A1-01       ---------------------------------cctggatcag-------
Q16548_BCL2A1-02       ---------------------------------cctggatcag-------
Q16548_BCL2A1-01       ---------------------------------cctggatcag-------
Q07817_BCL2L1-03       --------------------------gacagcccc--gcggtgaatggag
Q07817_BCL2L1-01       --------------------------gacagcccc--gcggtgaatggag
Q07817_BCL2L1-02       --------------------------gacagcccc--gcggtgaatggag
P10415_BCL2-04         ---------------------accccggctgcccccggcgccg-------
A9QXG9_BCL2-01         ---------------------accccggctgcccccggcgccg-------
P10415_BCL2-01         ---------------------accccggctgcccccggcgccg-------
P10415_BCL2-02         ---------------------accccggctgcccccggcgccg-------
Q92843_BCL2L2-02       ---------------------------gtgaccccaggctcag------c
Q9HD36_BCL2L10-01      --------------------tacctcggctaccccgggaaccgcttcgag
Q9HD36_BCL2L10-02      --------------------tacctcggctaccccgggaaccgcttcgag
C8YZ26_MCL1-01         ------------------------------------------g------g
Q07820_MCL1-03         ccggcagtcgctggagattatctctcggtaccttcgggagcag------g
B4DU51_MCL1-01         ccggcagtcgctggagattatctctcggtaccttcgggagcag------g
Q07820_MCL1-04         ------------------------------------------g------g
B4E3L8_MCL1-01         ccggcagtcgctggagattatctctcggtaccttcgggagcag------g
B4DLY8_MCL1-01         --------------------------------------------------
Q07820_MCL1-01         ccggcagtcgctggagattatctctcggtaccttcgggagcag------g
B4DG83_MCL1-01         ccggcagtcgctggagattatctctcggtaccttcgggagcag------g
                                                                         

B4E1X9_BCL2A1-01       --------gtccaagcaaaacgtccag-----------------------
Q16548_BCL2A1-02       --------gtccaagcaaaacgtccag-----------------------
Q16548_BCL2A1-01       --------gtccaagcaaaacgtccag-----------------------
Q07817_BCL2L1-03       ccactggccacagcagcagtttggatgccc-----------------ggg
Q07817_BCL2L1-01       ccactggccacagcagcagtttggatgccc-----------------ggg
Q07817_BCL2L1-02       ccactggccacagcagcagtttggatgccc-----------------ggg
P10415_BCL2-04         -ccgcggggcctg-------cgctcagccc--------------------
A9QXG9_BCL2-01         -ccgcggggcctg-------cgctcagccc--------------------
P10415_BCL2-01         -ccgcggggcctg-------cgctcagccc--------------------
P10415_BCL2-02         -ccgcggggcctg-------cgctcagccc--------------------
Q92843_BCL2L2-02       ccaacaacgctt--------cacccaggtctccgatgaactttttcaagg
Q9HD36_BCL2L10-01      ctggtggcgctgatggcggattccgtgctctccgacagcccc--------
Q9HD36_BCL2L10-02      ctggtggcgctgatggcggattccgtgctctccgacagcccc--------
C8YZ26_MCL1-01         ccaccggcgccaa----ggacacaaagccaatgggcaggtct--------
Q07820_MCL1-03         ccaccggcgccaa----ggacacaaagccaatgggcaggtct--------
B4DU51_MCL1-01         ccaccggcgccaa----ggacacaaagccaatgggcaggtct--------
Q07820_MCL1-04         ccaccggcgccaa----ggacacaaagccaatgggcaggtct--------
B4E3L8_MCL1-01         ccaccggcgccaa----ggacacaaagccaatgggcaggtct--------
B4DLY8_MCL1-01         ---------ccaa----ggacacaaagccaatgggcaggtct--------
Q07820_MCL1-01         ccaccggcgccaa----ggacacaaagccaatgggcaggtct--------
B4DG83_MCL1-01         ccaccggcgccaa----ggacacaaagccaatgggcaggtct--------
                                                 *                       

B4E1X9_BCL2A1-01       -agtgctaca--------aaatgttgcgttctcagtccaaaaagaagtgg
Q16548_BCL2A1-02       -agtgctaca--------aaatgttgcgttctcagtccaaaaagaagtgg
Q16548_BCL2A1-01       -agtgctaca--------aaatgttgcgttctcagtccaaaaagaagtgg
Q07817_BCL2L1-03       aggtgatccccatggcagcagtaaagc-----aagcgctgagggaggcag
Q07817_BCL2L1-01       aggtgatccccatggcagcagtaaagc-----aagcgctgagggaggcag
Q07817_BCL2L1-02       aggtgatccccatggcagcagtaaagc-----aagcgctgagggaggcag
P10415_BCL2-04         -ggtgccacc-----------tgtggtccacctgaccctccgccaggccg
A9QXG9_BCL2-01         -ggtgccacc-----------tgtggtccacctgaccctccgccaggccg
P10415_BCL2-01         -ggtgccacc-----------tgtggtccacctgaccctccgccaggccg
P10415_BCL2-02         -ggtgccacc-----------tgtggtccacctgaccctccgccaggccg
Q92843_BCL2L2-02       gggccccaactggggccgccttgtagccttctttgtctt---------tg
Q9HD36_BCL2L10-01      -ggccccacctggggcagagtggtgacgctcgtgacctt-cgcagggacg
Q9HD36_BCL2L10-02      -ggccccacctggggcagagtggtgacgctcgtgacctt-cgcagggacg
C8YZ26_MCL1-01         -ggggccacc---agcag---gaaggcgctggagaccttacgacgggttg
Q07820_MCL1-03         -ggggccacc---agcag---gaaggcgctggagaccttacgacgggttg
B4DU51_MCL1-01         -ggggccacc---agcag---gaaggcgctggagaccttacgacgggttg
Q07820_MCL1-04         -ggggccacc---agcag---gaaggcgctggagaccttacgacgggttg
B4E3L8_MCL1-01         -ggggccacc---agcag---gaaggcgctggagaccttacgacgggttg
B4DLY8_MCL1-01         -ggggccacc---agcag---gaaggcgctggagaccttacgacgggttg
Q07820_MCL1-01         -ggggccacc---agcag---gaaggcgctggagaccttacgacgggttg
B4DG83_MCL1-01         -ggggccacc---agcag---gaaggcgctggagaccttacgacgggttg
                         *                                              *

B4E1X9_BCL2A1-01       aaaagaatctgaagtcatgcttggacaatgttaatgttgtgtccgtagac
Q16548_BCL2A1-02       aaaagaatctgaagtcatgcttggacaatgttaatgttgtgtccgtagac
Q16548_BCL2A1-01       aaaagaatctgaagtcatgcttggacaatgttaatgttgtgtccgtagac
Q07817_BCL2L1-03       gcgacgagtttgaactgcggtaccggcgggcattcagtgacctgacatcc
Q07817_BCL2L1-01       gcgacgagtttgaactgcggtaccggcgggcattcagtgacctgacatcc
Q07817_BCL2L1-02       gcgacgagtttgaactgcggtaccggcgggcattcagtgacctgacatcc
P10415_BCL2-04         gcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagc
A9QXG9_BCL2-01         gcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagc
P10415_BCL2-01         gcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagc
P10415_BCL2-02         gcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagc
Q92843_BCL2L2-02       gggctgcactg-tgtgc--------------------tgagagtgtcaac
Q9HD36_BCL2L10-01      ctgctggagag-agggccgct-------------------ggtgaccgcc
Q9HD36_BCL2L10-02      ctgctggagag-agggccgct-------------------ggtgaccgcc
C8YZ26_MCL1-01         gggatggcgtgcagcgcaacca---------------cgagacggccttc
Q07820_MCL1-03         gggatggcgtgcagcgcaacca---------------cgagacggccttc
B4DU51_MCL1-01         gggatggcgtgcagcgcaacca---------------cgagacggccttc
Q07820_MCL1-04         gggatggcgtgcagcgcaacca---------------cgagacggccttc
B4E3L8_MCL1-01         gggatggcgtgcagcgcaacca---------------cgagacggccttc
B4DLY8_MCL1-01         gggatggcgtgcagcgcaacca---------------cgagacggccttc
Q07820_MCL1-01         gggatggcgtgcagcgcaacca---------------cgagacggccttc
B4DG83_MCL1-01         gggatggcgtgcagcgcaacca---------------cgagacggccttc
                                                                        *

B4E1X9_BCL2A1-01       ------------------------------------actgccagaacact
Q16548_BCL2A1-02       ------------------------------------actgccagaacact
Q16548_BCL2A1-01       ------------------------------------actgccagaacact
Q07817_BCL2L1-03       cag---------------ctccacatcaccccagggacagcatatcagag
Q07817_BCL2L1-01       cag---------------ctccacatcaccccagggacagcatatcagag
Q07817_BCL2L1-02       cag---------------ctccacatcaccccagggacagcatatcagag
P10415_BCL2-04         cag---------------ctgcacctgacgcccttcaccgcgcggggacg
A9QXG9_BCL2-01         cag---------------ctgcacctgacgcccttcaccgcgcggggacg
P10415_BCL2-01         cag---------------ctgcacctgacgcccttcaccgcgcggggacg
P10415_BCL2-02         cag---------------ctgcacctgacgcccttcaccgcgcggggacg
Q92843_BCL2L2-02       ------------------------------------aaggagatggaa--
Q9HD36_BCL2L10-01      cggtg-------------------------------gaagaagtggg---
Q9HD36_BCL2L10-02      cggtg-------------------------------gaagaagtggg---
C8YZ26_MCL1-01         caaggcatgcttcggagactggacatcaaaaacgaagacgatgtgaaatc
Q07820_MCL1-03         caa-----------------------------------------------
B4DU51_MCL1-01         caaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatc
Q07820_MCL1-04         caaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatc
B4E3L8_MCL1-01         caaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatc
B4DLY8_MCL1-01         caaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatc
Q07820_MCL1-01         caaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatc
B4DG83_MCL1-01         caaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatc
                                                                         

B4E1X9_BCL2A1-01       attcaaccaagtgatggaaaaggagtttgaagacggcatcattaactggg
Q16548_BCL2A1-02       attcaaccaagtgatggaaaaggagtttgaagacggcatcattaactggg
Q16548_BCL2A1-01       attcaaccaagtgatggaaaaggagtttgaagacggcatcattaactggg
Q07817_BCL2L1-03       ctttgaacaggtagtgaatgaactcttccgggatggggtaa---actggg
Q07817_BCL2L1-01       ctttgaacaggtagtgaatgaactcttccgggatggggtaa---actggg
Q07817_BCL2L1-02       ctttgaaca-----------------------------------------
P10415_BCL2-04         ctttgccacggtggtggaggagctcttcagggacggggtga---actggg
A9QXG9_BCL2-01         ctttgccacggtggtggaggagctcttcagggacggggtga---actggg
P10415_BCL2-01         ctttgccacggtggtggaggagctcttcagggacggggtga---actggg
P10415_BCL2-02         ctttgccacggtggtggaggagctcttcagggacggggtga---actggg
Q92843_BCL2L2-02       --------------------------ccactggtgggacaa-------gt
Q9HD36_BCL2L10-01      ----------------------gcttccagccgcggctaaa------gga
Q9HD36_BCL2L10-02      ----------------------gcttccagccgcggctaaa------gga
C8YZ26_MCL1-01         gttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggg
Q07820_MCL1-03         --------------------------------------------------
B4DU51_MCL1-01         gttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggg
Q07820_MCL1-04         gttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggg
B4E3L8_MCL1-01         gttgtctcgagtgatgatccatgttttcagcgacagcgtaacaaactggg
B4DLY8_MCL1-01         gttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggg
Q07820_MCL1-01         gttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggg
B4DG83_MCL1-01         gttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggg
                                                                         

B4E1X9_BCL2A1-01       gaagaattgtaac-------------------------------------
Q16548_BCL2A1-02       gaagaattgtaac-------------------------------------
Q16548_BCL2A1-01       gaagaattgtaac-------------------------------------
Q07817_BCL2L1-03       gtcgcattgtggc------ctttttctccttcggcggggcactgtgcgtg
Q07817_BCL2L1-01       gtcgcattgtggc------ctttttctccttcggcggggcactgtgcgtg
Q07817_BCL2L1-02       --------------------------------------------------
P10415_BCL2-04         ggaggattgtggc------cttctttgagttcggtggggtcatgtgtgtg
A9QXG9_BCL2-01         ggaggattgtggc------cttctttgagttcggtggggtcatgtgtgtg
P10415_BCL2-01         ggaggattgtggc------cttctttgagttcggtggggtcatgtgtgtg
P10415_BCL2-02         ggaggattgtggc------cttctttgagttcggtggggtcatgtgtgtg
Q92843_BCL2L2-02       gcaggagtgga-------------------------------------tg
Q9HD36_BCL2L10-01      gcaggagggcgac-------------gtcgcccgggactgccagcgcctg
Q9HD36_BCL2L10-02      gcaggagggcgac-------------gtcgcccgggactgccagcgcctg
C8YZ26_MCL1-01         gcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttg
Q07820_MCL1-03         --------------------------------------------------
B4DU51_MCL1-01         gcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttg
Q07820_MCL1-04         gcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttg
B4E3L8_MCL1-01         gcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttg
B4DLY8_MCL1-01         gcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttg
Q07820_MCL1-01         gcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttg
B4DG83_MCL1-01         gcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttg
                                                                         

B4E1X9_BCL2A1-01       -----------------------catatttgcatttgaaggtattctcat
Q16548_BCL2A1-02       -----------------------catatttgcatttgaaggtattctcat
Q16548_BCL2A1-01       -----------------------catatttgcatttgaaggtattctcat
Q07817_BCL2L1-03       gaaagcgtagacaaggag------atgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-01       gaaagcgtagacaaggag------atgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-02       --------------------------------------------------
P10415_BCL2-04         gagagcgtcaaccgggag------atgtcgcccctggtggacaacatcgc
A9QXG9_BCL2-01         gagagcgtcaaccgggag------atgtcgcccctggtggacaacatcgc
P10415_BCL2-01         gagagcgtcaaccgggag------atgtcgcccctggtggacaacatcgc
P10415_BCL2-02         gagagcgtcaaccgggag------atgtcgcccctggtggacaacatcgc
Q92843_BCL2L2-02       gtggccta------------------------------------------
Q9HD36_BCL2L10-01      gtggcctt-----------gctgagc--------------------tcgc
Q9HD36_BCL2L10-02      gtggcctt-----------gctgagc--------------------tcgc
C8YZ26_MCL1-01         aagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcac
Q07820_MCL1-03         --------------------------------------------------
B4DU51_MCL1-01         aagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcac
Q07820_MCL1-04         aagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcac
B4E3L8_MCL1-01         aagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcac
B4DLY8_MCL1-01         aagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcac
Q07820_MCL1-01         aagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcac
B4DG83_MCL1-01         aagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcac
                                                                         

B4E1X9_BCL2A1-01       caagaaacttctacgacagc------aaattgccccggatgtggatacct
Q16548_BCL2A1-02       caagaaacttctacgacagc------aaattgccccggatgtggatacct
Q16548_BCL2A1-01       caagaaacttctacgacagc------aaattgccccggatgtggatacct
Q07817_BCL2L1-03       ag---------cttggatggccacttacctgaatgaccacctagagcctt
Q07817_BCL2L1-01       ag---------cttggatggccacttacctgaatgaccacctagagcctt
Q07817_BCL2L1-02       --------------------------------------------------
P10415_BCL2-04         ---------cctgtggatgactgagtacctgaaccggcacctgcacacct
A9QXG9_BCL2-01         ---------cctgtggatgactgagtacctgaaccggcacctgcacacct
P10415_BCL2-01         ---------cctgtggatgactgagtacctgaaccggcacctgcacacct
P10415_BCL2-02         ---------cctgtggatgactgagtacctgaaccggcacctgcacacct
Q92843_BCL2L2-02       ---------cctggagacgc------agctgg-ctga-----------ct
Q9HD36_BCL2L10-01      gg-----ctcatggggcagc------accgcgcctgg-----------ct
Q9HD36_BCL2L10-02      gg-----ctcatggggcagc------accgcgcctgg-----------ct
C8YZ26_MCL1-01         agacgttctcgtaaggacaa------aacgggactgg-----------ct
Q07820_MCL1-03         --------------------------------------------------
B4DU51_MCL1-01         agacgttctcgtaaggacaa------aacgggactgg-----------ct
Q07820_MCL1-04         agacgttctcgtaaggacaa------aacgggactgg-----------ct
B4E3L8_MCL1-01         agacgttctcgtaaggacaa------aacgggactgg-----------ct
B4DLY8_MCL1-01         agacgttctcgtaaggacaa------aacgggactgg-----------ct
Q07820_MCL1-01         agacgttctcgtaaggacaa------aacgggactgg-----------ct
B4DG83_MCL1-01         agacgttctcgtaaggacaa------aacgggactgg-----------ct
                                                                         

B4E1X9_BCL2A1-01       ataa----------ggagatttc---------------------------
Q16548_BCL2A1-02       ataa----------ggagatttc---------------------------
Q16548_BCL2A1-01       ataa----------ggagatttc---------------------------
Q07817_BCL2L1-03       ggatccaggagaacggcggctg----------------------------
Q07817_BCL2L1-01       ggatccaggagaacggcggctg----------------------------
Q07817_BCL2L1-02       --------------------------------------------------
P10415_BCL2-04         ggatccaggataacggaggctg----------------------------
A9QXG9_BCL2-01         ggatccaggataacggaggctg----------------------------
P10415_BCL2-01         ggatccaggataacggaggctg----------------------------
P10415_BCL2-02         ggatccaggataacggaggctg----------------------------
Q92843_BCL2L2-02       ggatccacagcagtgggggct-----------------------------
Q9HD36_BCL2L10-01      gcaggctcag----ggcggctg----------------------------
Q9HD36_BCL2L10-02      gcaggctcag----ggcggctgggtgagcacgcggcggacaccgggacac
C8YZ26_MCL1-01         agttaaacaa----agaggctg----------------------------
Q07820_MCL1-03         --------------------------------------------------
B4DU51_MCL1-01         agttaaacaa----agaggctg----------------------------
Q07820_MCL1-04         agttaaacaa----agaggctg----------------------------
B4E3L8_MCL1-01         agttaaacaa----agaggctg----------------------------
B4DLY8_MCL1-01         agttaaacaa----agaggctg----------------------------
Q07820_MCL1-01         agttaaacaa----agaggctg----------------------------
B4DG83_MCL1-01         agttaaacaa----agaggctg----------------------------
                                                                         

B4E1X9_BCL2A1-01       ------------------------------------------atattttg
Q16548_BCL2A1-02       ------------------------------------------atattttg
Q16548_BCL2A1-01       ------------------------------------------atattttg
Q07817_BCL2L1-03       ------------------------------------------ggatactt
Q07817_BCL2L1-01       ------------------------------------------ggatactt
Q07817_BCL2L1-02       ------------------------------------------ggatactt
P10415_BCL2-04         ------------------------------------------gg------
A9QXG9_BCL2-01         ------------------------------------------ggatgcct
P10415_BCL2-01         ------------------------------------------ggatgcct
P10415_BCL2-02         ------------------------------------------ggatgcct
Q92843_BCL2L2-02       ------------------------------------------gggcggag
Q9HD36_BCL2L10-01      ------------------------------------------ggatggct
Q9HD36_BCL2L10-02      ggggcgggacgggcagccgggaagcgcccacgaggctggcacggatggct
C8YZ26_MCL1-01         ------------------------------------------ggatgggt
Q07820_MCL1-03         ------------------------------------------ggatgggt
B4DU51_MCL1-01         ------------------------------------------ggatgggt
Q07820_MCL1-04         ------------------------------------------ggatgggt
B4E3L8_MCL1-01         ------------------------------------------ggatgggt
B4DLY8_MCL1-01         ------------------------------------------ggatgggt
Q07820_MCL1-01         ------------------------------------------ggatgggt
B4DG83_MCL1-01         ------------------------------------------ggatgggt
                                                                         

B4E1X9_BCL2A1-01       ttgcggagttcataatgaataacacaggagaa-----------------t
Q16548_BCL2A1-02       ttgcggagttcataatgaataacacaggagaa-----------------t
Q16548_BCL2A1-01       ttgcggagttcataatgaataacacaggagaa-----------------t
Q07817_BCL2L1-03       ttgtggaactc----tat-------gggaaca----------------at
Q07817_BCL2L1-01       ttgtggaactc----tat-------gggaaca----------------at
Q07817_BCL2L1-02       ttgtggaactc----tat-------gggaaca----------------at
P10415_BCL2-04         --------------------------------------------------
A9QXG9_BCL2-01         ttgtggaactg----tac--------ggcccc------------------
P10415_BCL2-01         ttgtggaactg----tac--------ggcccc------------------
P10415_BCL2-02         ttgtggaactg----tac--------ggcccc------------------
Q92843_BCL2L2-02       ttcacagctct----atacggggacggggccc-----------------t
Q9HD36_BCL2L10-01      tttgtcacttc----ttc-------aggaccccctttccactggcttttt
Q9HD36_BCL2L10-02      tttgtcacttc----ttc-------aggaccccctttccactggcttttt
C8YZ26_MCL1-01         ttgtggagttc----ttccaagtagaggacct------------------
Q07820_MCL1-03         ttgtggagttc----ttccatgtagaggacct------------------
B4DU51_MCL1-01         ttgtggagttc----ttccatgtagaggacct------------------
Q07820_MCL1-04         ttgtggagttc----ttccatgtagaggacct------------------
B4E3L8_MCL1-01         ttgtggagttc----ttccatgtagaggacct------------------
B4DLY8_MCL1-01         ttgtggagttc----ttccatgtagaggacct------------------
Q07820_MCL1-01         ttgtggagttc----ttccatgtagaggacct------------------
B4DG83_MCL1-01         ttgtggagttc----ttccatgtagaggacct------------------
                                                                         

B4E1X9_BCL2A1-01       ggataaggcaaaacggaggct-gggtatgtgtgatggaaaaattcttcat
Q16548_BCL2A1-02       ggataaggcaaaacggaggctgggggaaatggc-------acaatcacac
Q16548_BCL2A1-01       ggataaggcaaaacggaggct-gggaaaatggctttgtaaagaagtttga
Q07817_BCL2L1-03       gcagcagcc-----------gagagccgaaagggccaggaacgcttcaac
Q07817_BCL2L1-01       gcagcagcc-----------gagagccgaaagggccaggaacgcttcaac
Q07817_BCL2L1-02       gcagcagcc-----------gagagccgaaagggccaggaacgcttcaac
P10415_BCL2-04         -------------------------------------------taggtgc
A9QXG9_BCL2-01         --agcatgc------------------------ggcctctgtttgatttc
P10415_BCL2-01         --agcatgc------------------------ggcctctgtttgatttc
P10415_BCL2-02         --agcatgc------------------------ggcctctgtttgatttc
Q92843_BCL2L2-02       ggaggaggcgcggcgtctgcgggaggggaactgggcatcagtgaggacag
Q9HD36_BCL2L10-01      ggagaaaac------------------------agc-----------tgg
Q9HD36_BCL2L10-02      ggagaaaac------------------------agc-----------tgg
C8YZ26_MCL1-01         --agaaggt------------------------ggcatcag-gaatgtgc
Q07820_MCL1-03         --agaaggt------------------------ggcatcag-gaatgtgc
B4DU51_MCL1-01         --agaaggt------------------------ggcatcag-gaatgtgc
Q07820_MCL1-04         --agaaggt------------------------ggcatcag-gaatgtgc
B4E3L8_MCL1-01         --agaaggt------------------------ggcatcag-gaatgtgc
B4DLY8_MCL1-01         --agaaggt------------------------ggcatcag-gaatgtgc
Q07820_MCL1-01         --agaaggt------------------------ggcatcag-gaatgtgc
B4DG83_MCL1-01         --agaaggt------------------------ggcatcag-gaatgtgc
                                                                         

B4E1X9_BCL2A1-01       tgttctttcctgtgaaat----------------------agaaattgag
Q16548_BCL2A1-02       acctatg-ctggtagagtcag----------tggcccacaagaagaggaa
Q16548_BCL2A1-01       acctaaatctggctggatgac----------ttttctagaagttacagga
Q07817_BCL2L1-03       cgctggttcctgacgg---------------gcatgactg------tggc
Q07817_BCL2L1-01       cgctggttcctgacgg---------------gcatgactg------tggc
Q07817_BCL2L1-02       cgctggttcctgacgg---------------gcatgactg------tggc
P10415_BCL2-04         acttgg-------------------------------tga------tgtg
A9QXG9_BCL2-01         tcctggctgtctctgaagactctgctcagtttggccctgg------tggg
P10415_BCL2-01         tcctggctgtctctgaagactctgctcagtttggccctgg------tggg
P10415_BCL2-02         tcctggctgtctctgaagactctgctcagtttggccctgg------tggg
Q92843_BCL2L2-02       tgctgacgggggcc-g---------------tggcactgggggccctggt
Q9HD36_BCL2L10-01      tccaggcttttct--g---------------tcatgcttg-t----taac
Q9HD36_BCL2L10-02      tccaggcttttct--g---------------tcatgcttg-t----taac
C8YZ26_MCL1-01         tgctggcttttgcagg---------------tgttgctggag----tagg
Q07820_MCL1-03         tgctggcttttgcagg---------------tgttgctggag----tagg
B4DU51_MCL1-01         tgctggcttttgcagg---------------tgttgctggag----tagg
Q07820_MCL1-04         tgctggcttttgcagg---------------tgttgctggag----tagg
B4E3L8_MCL1-01         tgctggcttttgcagg---------------tgttgctggag----tagg
B4DLY8_MCL1-01         tgctggcttttgcagg---------------tgttgctggag----tagg
Q07820_MCL1-01         tgctggcttttgcagg---------------tgttgctggag----tagg
B4DG83_MCL1-01         tgctggcttttgcagg---------------tgttgctggag----tagg
                                                                         

B4E1X9_BCL2A1-01       aatttccttgcta------------------------gttaa--------
Q16548_BCL2A1-02       aatggctttgtaa-------------------------------------
Q16548_BCL2A1-01       aagatctgtgaaatgctatctctcctgaagcaatactgttga--------
Q07817_BCL2L1-03       cggcgtggttctgctgggctcactcttcagtcgga--aatga--------
Q07817_BCL2L1-01       cggcgtggttctgctgggctcactcttcagtcgga--aatga--------
Q07817_BCL2L1-02       cggcgtggttctgctgggctcactcttcagtcgga--aatga--------
P10415_BCL2-04         ag----------------------tctgggc--------tga--------
A9QXG9_BCL2-01         agcttgcatcaccctgggtgcctatctgagccaca--agtga--------
P10415_BCL2-01         agcttgcatcaccctgggtgcctatctgggccaca--agtga--------
P10415_BCL2-02         agcttgcatcaccctgggtgcctatctgggccaca--agtga--------
Q92843_BCL2L2-02       aactgtaggg---------gccttttttgctagca--agtga--------
Q9HD36_BCL2L10-01      aacagccttc---------atttatctctggacac--gattattatga--
Q9HD36_BCL2L10-02      aacagccttc---------atttatctctggacac--gattattatgagt
C8YZ26_MCL1-01         agctggtttg---------gcatatct---aaaaa--gatag--------
Q07820_MCL1-03         agctggtttg---------gcatatct---aataa--gatagccttactg
B4DU51_MCL1-01         agctggtttg---------gcatatct---aataa--gatag--------
Q07820_MCL1-04         agctggtttg---------gcatatct---aataa--gatag--------
B4E3L8_MCL1-01         agctggtttg---------gcatatct---aataa--gatag--------
B4DLY8_MCL1-01         agctggtttg---------gcatatct---aataa--gatag--------
Q07820_MCL1-01         agctggtttg---------gcatatct---aataa--gatag--------
B4DG83_MCL1-01         agctggtttg---------gcatatct---aataa--gatag--------
                                                                         

B4E1X9_BCL2A1-01       ---------------------------------------
Q16548_BCL2A1-02       ---------------------------------------
Q16548_BCL2A1-01       ---------------------------------------
Q07817_BCL2L1-03       ---------------------------------------
Q07817_BCL2L1-01       ---------------------------------------
Q07817_BCL2L1-02       ---------------------------------------
P10415_BCL2-04         ---------------------------------------
A9QXG9_BCL2-01         ---------------------------------------
P10415_BCL2-01         ---------------------------------------
P10415_BCL2-02         ---------------------------------------
Q92843_BCL2L2-02       ---------------------------------------
Q9HD36_BCL2L10-01      ---------------------------------------
Q9HD36_BCL2L10-02      tttaaaacttttaacccgcttctacctgcccaactgtga
C8YZ26_MCL1-01         ---------------------------------------
Q07820_MCL1-03         taa------------------------------------
B4DU51_MCL1-01         ---------------------------------------
Q07820_MCL1-04         ---------------------------------------
B4E3L8_MCL1-01         ---------------------------------------
B4DLY8_MCL1-01         ---------------------------------------
Q07820_MCL1-01         ---------------------------------------
B4DG83_MCL1-01         ---------------------------------------
                                                              

© 1998-2018