Dataset for CDS BCL2L1 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q07817_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-03      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q07817_BCL2L1-02      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                      **************************************************

Q07817_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-03      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q07817_BCL2L1-02      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
                      **************************************************

Q07817_BCL2L1-01      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-03      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
Q07817_BCL2L1-02      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
                      **************************************************

Q07817_BCL2L1-01      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-03      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
Q07817_BCL2L1-02      atcaatggcaacccatcctggcacctggcagacagccccgcggtgaatgg
                      **************************************************

Q07817_BCL2L1-01      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-03      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
Q07817_BCL2L1-02      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
                      **************************************************

Q07817_BCL2L1-01      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-03      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
Q07817_BCL2L1-02      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
                      **************************************************

Q07817_BCL2L1-01      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-03      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
Q07817_BCL2L1-02      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
                      **************************************************

Q07817_BCL2L1-01      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-03      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
Q07817_BCL2L1-02      gacagcatatcagagctttgaaca--------------------------
                      ************************                          

Q07817_BCL2L1-01      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-03      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
Q07817_BCL2L1-02      --------------------------------------------------
                                                                        

Q07817_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-03      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q07817_BCL2L1-02      --------------------------------------------------
                                                                        

Q07817_BCL2L1-01      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-03      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q07817_BCL2L1-02      --------------------------------------------------
                                                                        

Q07817_BCL2L1-01      agaacggcggctgggatacttttgtggaactctatgggaacaatgcagca
Q07817_BCL2L1-03      agaacggcggctgggatacttttgtggaactctatgggaacaatgcagca
Q07817_BCL2L1-02      -------------ggatacttttgtggaactctatgggaacaatgcagca
                                   *************************************

Q07817_BCL2L1-01      gccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacggg
Q07817_BCL2L1-03      gccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacggg
Q07817_BCL2L1-02      gccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacggg
                      **************************************************

Q07817_BCL2L1-01      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
Q07817_BCL2L1-03      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
Q07817_BCL2L1-02      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
                      **************************************************

Q07817_BCL2L1-01      ga
Q07817_BCL2L1-03      ga
Q07817_BCL2L1-02      ga
                      **

© 1998-2019