Dataset for CDS BCL-2-like of organism Hippocampus comes

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3DUT7_BCL2L1-      atg-----------------------------------------------
A0A3Q3DUT7_BCL2L1-      atg-----------------------------------------------
A0A3Q3DUT7_BCL2L1-      atg-----------------------------------------------
A0A3Q2XZL8_MCL1-01      atgagtatggtgcagcccacaagccaagttctgaagccccaaggccgccc
A0A3Q2Y539_MCL1-01      atg---------------------------ccggagagtaaacgctttcc
                        ***                                               

A0A3Q3DUT7_BCL2L1-      ---------tctcaaaa------tcgagaactggttttgttttacattag
A0A3Q3DUT7_BCL2L1-      ---------tctcaaaa------tcgagaactggttttgttttacattag
A0A3Q3DUT7_BCL2L1-      ---------tctcaaaa------tcgagaactggttttgttttacattag
A0A3Q2XZL8_MCL1-01      catgcgc--ccacaaaa-tggagtcgcggaaggctt---------attgc
A0A3Q2Y539_MCL1-01      cctgtataacttcaaggttggactcgtggacgcttt---------aatg-
                                    ***        *** * *    **         * *  

A0A3Q3DUT7_BCL2L1-      gtacaaactttcccagaaaaactaccc--------------gctcaacca
A0A3Q3DUT7_BCL2L1-      gtacaaactttcccagaaaaactaccc--------------gctcaacca
A0A3Q3DUT7_BCL2L1-      gtacaaactttcccagaaaaactaccc--------------gctcaacca
A0A3Q2XZL8_MCL1-01      aatgcaactctccccccgtcgccgccgcgtccacatcgccgccacagctt
A0A3Q2Y539_MCL1-01      --------ttgcctccaaaggctgtcg---------------------tt
                                *  **        *   *                        

A0A3Q3DUT7_BCL2L1-      cataggactcagacaggcattgaacaggactgatggcagggaggaagc--
A0A3Q3DUT7_BCL2L1-      cataggactcagacaggcattgaacaggactgatggcagggaggaagc--
A0A3Q3DUT7_BCL2L1-      cataggactcagacaggcattgaacaggactgatggcagggaggaagc--
A0A3Q2XZL8_MCL1-01      catcgggccgtggc-gaccttgggcgccgttaactgcaacagcggggccg
A0A3Q2Y539_MCL1-01      caaggatccatgg----cctcg--------cagctgcaggaggtggaacg
                        **  *  *   *     * * *             ***            

A0A3Q3DUT7_BCL2L1-      -----------------------------ctcaggcgaggaggagcagcg
A0A3Q3DUT7_BCL2L1-      -----------------------------ctcaggcgaggaggagcagcg
A0A3Q3DUT7_BCL2L1-      -----------------------------ctcaggcgaggaggagcagcg
A0A3Q2XZL8_MCL1-01      ccaagccccgacctagcgccttggaaattctctgcaagggcggactagcc
A0A3Q2Y539_MCL1-01      tcg--------------------------ttctg----------------
                                                      ** *                

A0A3Q3DUT7_BCL2L1-      ggtacagacgcctgccaatgggacgac-----------caacggcaccag
A0A3Q3DUT7_BCL2L1-      ggtacagacgcctgccaatgggacgac-----------caacggcaccag
A0A3Q3DUT7_BCL2L1-      ggtacagacgcctgccaatgggacgac-----------caacggcaccag
A0A3Q2XZL8_MCL1-01      accatgaaccaccgcaacaacagcgacgacgacttcgatgtggaaagcag
A0A3Q2Y539_MCL1-01      ----------------ataacagcgac------------atggatgaagg
                                        *      ****               *      *

A0A3Q3DUT7_BCL2L1-      tcccccggcgtcgccg---------------------ctacgagaggcgg
A0A3Q3DUT7_BCL2L1-      tcccccggcgtcgccg---------------------ctacgagaggcgg
A0A3Q3DUT7_BCL2L1-      tcccccggcgtcgccg---------------------ctacgagaggcgg
A0A3Q2XZL8_MCL1-01      cgacgactcaccaccgagtacccccgactcccaggactcactagtcgccg
A0A3Q2Y539_MCL1-01      cgcccagccgttgccg---------gagctccaaacccctcc--------
                           *    *    ***                        *         

A0A3Q3DUT7_BCL2L1-      cgagcctggacgcggtgaaggaggccctgcgggactcggccaatgagttt
A0A3Q3DUT7_BCL2L1-      cgagcctggacgcggtgaaggaggccctgcgggactcggccaatgagttt
A0A3Q3DUT7_BCL2L1-      cgagcctggacgcggtgaaggaggccctgcgggactcggccaatgagttt
A0A3Q2XZL8_MCL1-01      acggccgcaacgacgtggtggacgc----cgagaccaagg------gcct
A0A3Q2Y539_MCL1-01      -cggcc---aaggcgtcttggacac----cgagacgagac------gtct
                           ***   * *  **   ***  *    ** ***           *  *

A0A3Q3DUT7_BCL2L1-      gagttg-cgctactcccacgccttcagcgacctg--gacaaacagctgca
A0A3Q3DUT7_BCL2L1-      gagttg-cgctactcccacgccttcagcgacctg--gacaaacagctgca
A0A3Q3DUT7_BCL2L1-      gagttg-cgctactcccacgccttcagcgacctg--gacaaacagctgca
A0A3Q2XZL8_MCL1-01      cattagacgttttctcacagactttaccggcctgtcgactgctagctgga
A0A3Q2Y539_MCL1-01      catcggccgcttcctccgtgactttaccgggctgtccactgctgcttgga
                         *   * ** *    *   * *** * **  ***   **       ** *

A0A3Q3DUT7_BCL2L1-      cattacaccggccactgcctacca--------------------------
A0A3Q3DUT7_BCL2L1-      cattacaccggccactgcctacca--------------------------
A0A3Q3DUT7_BCL2L1-      cattacaccggccactgcctacca--------------------------
A0A3Q2XZL8_MCL1-01      acgaaagcaaggcacattcgaccatgaaaagagtcgtggctaaggttttg
A0A3Q2Y539_MCL1-01      tccaaagcaaagcccagtcgacaatgaagagggtcgtgacgagactggtg
                            *  *    * *   * ** *                          

A0A3Q3DUT7_BCL2L1-      ---aagc-----------tttgagaacgttgtggatgaggtgttccagga
A0A3Q3DUT7_BCL2L1-      ---aagc-----------tttgagaacgttgtggatgaggtgttccagga
A0A3Q3DUT7_BCL2L1-      ---aagc-----------tttgagaacgttgtggatgaggtgttccagga
A0A3Q2XZL8_MCL1-01      gaaaagcacaagtacaagtacaatggtatcatcaacaaattgtctctgga
A0A3Q2Y539_MCL1-01      gacaagcacaggatcttattcaataacatggtcaacgaactgtcactgga
                           ****           *   *     *  *  *  *  ***  * ***

A0A3Q3DUT7_BCL2L1-      cga-----------------------------------------------
A0A3Q3DUT7_BCL2L1-      cga-----------------------------------------------
A0A3Q3DUT7_BCL2L1-      cga-----------------------------------------------
A0A3Q2XZL8_MCL1-01      cgaccgaggggacaacgtgagcttcatcagtgaagtagccaagagcctgt
A0A3Q2Y539_MCL1-01      ccaaagagggctcgacaggtcctttgtcagccaggtggcccaaacggaat
                        * *                                               

A0A3Q3DUT7_BCL2L1-      -------------cgtcaactggggccgcatcgtggggctcttcgcgttc
A0A3Q3DUT7_BCL2L1-      -------------cgtcaactggggccgcatcgtggggctcttcgcgttc
A0A3Q3DUT7_BCL2L1-      -------------cgtcaactggggccgcatcgtggggctcttcgcgttc
A0A3Q2XZL8_MCL1-01      tttcggatgggacaaccaactgggggcgcgtggccagcttggtggccttt
A0A3Q2Y539_MCL1-01      tcgccaatgggaacattaactggggtcgcatcgccagcctgttggccttc
                                         ******** *** * *   *  *  * ** ** 

A0A3Q3DUT7_BCL2L1-      ggcggcgcgctgtgcgtcgaatgcatggagaaggagatgatccccctggt
A0A3Q3DUT7_BCL2L1-      ggcggcgcgctgtgcgtcgaatgcatggagaaggagatgatccccctggt
A0A3Q3DUT7_BCL2L1-      ggcggcgcgctgtgcgtcgaatgcatggagaaggagatgatccccctggt
A0A3Q2XZL8_MCL1-01      ggggccattgtgtcccagcacctgaaagaaaagggccgggcccactgtgt
A0A3Q2Y539_MCL1-01      tgtgccgtgctgtctcaagccttgaaagaaaatcagcaggagaggtgcgt
                         * * *    ***           *  ** **      *         **

A0A3Q3DUT7_BCL2L1-      tgacaggatcatcgagtggatgacggtgtacctggacaaccaccttcagc
A0A3Q3DUT7_BCL2L1-      tgacaggatcatcgagtggatgacggtgtacctggacaaccaccttcagc
A0A3Q3DUT7_BCL2L1-      tgacaggatcatcgagtggatgacggtgtacctggacaaccaccttcagc
A0A3Q2XZL8_MCL1-01      ggagccggtggccgatgagatctcttcgtatctgctgtcgcaccagcgca
A0A3Q2Y539_MCL1-01      ggaactggtggcccaggaggtctcgacctacttgctgtcacaccagcgca
                         **   * *   * *   * *  *    **  **      ****  *   

A0A3Q3DUT7_BCL2L1-      cctggatagagagccaaggaggatggcaacgctttgccgaaatttttggc
A0A3Q3DUT7_BCL2L1-      cctggatagagagccaaggaggatggcaacgctttgccgaaatttttggc
A0A3Q3DUT7_BCL2L1-      cctggatagagagccaaggaggatggcaacgctttgccgaaatttttggc
A0A3Q2XZL8_MCL1-01      actggctggtgaaaaacaactcttgggatggctttgtacaattctttcgg
A0A3Q2Y539_MCL1-01      cctggctagtgcagcacaacggttgggatggatttgcagaattcttcaag
                         **** * * *    *       *** *  * ****   ** * **    

A0A3Q3DUT7_BCL2L1-      cacgacgcggcagcggaggtccgccgctcccaggagagtttcaagaagtg
A0A3Q3DUT7_BCL2L1-      cacgacgcggcagcggaggtccgccgctcccaggagagtttcaagaagtg
A0A3Q3DUT7_BCL2L1-      cacgacgcggcagcggaggtccgccgctcccaggagagtttcaagaagtg
A0A3Q2XZL8_MCL1-01      gaagtgg----atcctgagtctacagtg---aggaacacattaa----tg
A0A3Q2Y539_MCL1-01      gaagacg----acctggagtctacagtg---aggaatggcctct----tc
                         * *  *    * *    ***  * *     ****             * 

A0A3Q3DUT7_BCL2L1-      gcttttggccggggtgaccttggtgac--cggggtcgtggtgggctcgct
A0A3Q3DUT7_BCL2L1-      gcttttggccggggtgaccttggtgac--cggggtcgtggtgggctcgct
A0A3Q3DUT7_BCL2L1-      gcttttggccggggtgaccttggtgac--cggggtcgtggtgggctcgct
A0A3Q2XZL8_MCL1-01      gccttt-gctggagtggctggcat-----tggcgccacactggccctgtt
A0A3Q2Y539_MCL1-01      gccttt-gttggtttggtcagcgtcactgcagcgctacgctgtc-----t
                        ** *** *  **  **       *       * *      **       *

A0A3Q3DUT7_BCL2L1-      catcgcccagaagcgcctgtga
A0A3Q3DUT7_BCL2L1-      catcgcccagaagcgcctgtga
A0A3Q3DUT7_BCL2L1-      catcgcccagaagcgcctgtga
A0A3Q2XZL8_MCL1-01      gat------------caggtga
A0A3Q2Y539_MCL1-01      gat------------tcgatga
                         **                ***

© 1998-2019