Dataset for CDS BCL-2 of organism Hippocampus comes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2XQX2_BCL2-01      atggcgaacgagcgaaatcgcaccattgtggagaattatatctgccataa
A0A3Q2XQX2_BCL2-02      atggcgaacgagcgaaatcgcaccattgtggagaattatatctgccataa
                        **************************************************

A0A3Q2XQX2_BCL2-01      actctccaaacgcggctacgcgtgggggttcggtgccgaggacgatgccg
A0A3Q2XQX2_BCL2-02      actctccaaacgcggctacgcgtgggggttcggtgccggggaggaggacg
                        ************************************** *** ** * **

A0A3Q2XQX2_BCL2-01      ccgctgctaataacggcttattggttgcaccctcgccgactttggtgctc
A0A3Q2XQX2_BCL2-02      --------------------------------------------------
                                                                          

A0A3Q2XQX2_BCL2-01      cggtgccgcgaagccagctccgggcccgagcgcgactgcgcccccaagcg
A0A3Q2XQX2_BCL2-02      ----------------------------------------------atcg
                                                                      * **

A0A3Q2XQX2_BCL2-01      aagccacggttccgacccgctcgccgatatccaccgggtcctgcgtgagg
A0A3Q2XQX2_BCL2-02      aagccacggttccgacccgctcgccgatatccaccgggtcctgcgtgagg
                        **************************************************

A0A3Q2XQX2_BCL2-01      ccggcgacgaactcgagagactttaccagccggatttcaccgagatgtcc
A0A3Q2XQX2_BCL2-02      ccggcgacgaactcgagagactttaccagccggatttcaccgagatgtcc
                        **************************************************

A0A3Q2XQX2_BCL2-01      cgacagctgtacctctcgtccactacagctcagaggcggttcgccgaggt
A0A3Q2XQX2_BCL2-02      cgacagctgtacctctcgtccactacagctcagaggcggttcgccgaggt
                        **************************************************

A0A3Q2XQX2_BCL2-01      gatcgacgaactgttccgggacggcgtcaactggggccggatcatcgcct
A0A3Q2XQX2_BCL2-02      gatcgacgaactgttccgggacggcgtcaactggggccggatcatcgcct
                        **************************************************

A0A3Q2XQX2_BCL2-01      tcttcgagttcggcggcaccgtgtgcgtggagtgcgccactaaggaggac
A0A3Q2XQX2_BCL2-02      tcttcgagttcggcggcaccgtgtgcgtggagtgcgccactaaggaggac
                        **************************************************

A0A3Q2XQX2_BCL2-01      atgacgtcgcaagtggacaacatagccgagtggatgactgagtacttaaa
A0A3Q2XQX2_BCL2-02      atgacgtcgcaagtggacaacatagccgagtggatgactgagtacttaaa
                        **************************************************

A0A3Q2XQX2_BCL2-01      cggacccctaggcagctggatccaagacaacgggggctgggatgcttttg
A0A3Q2XQX2_BCL2-02      cggacccctaggcagctggatccaagacaacgggggctgggatgcttttg
                        **************************************************

A0A3Q2XQX2_BCL2-01      tggagctctacgaccgtcagagggactctgtcttcagctgcacgtggccg
A0A3Q2XQX2_BCL2-02      tggagctctacgaccgtcagagggactctgtcttcagctgcacgtggccg
                        **************************************************

A0A3Q2XQX2_BCL2-01      tccatcaagacagtcttcggcctggccgcgctcggggcggccagcctcac
A0A3Q2XQX2_BCL2-02      tccatcaagacagtcttcggcctggccgcgctcggggcggccagcctcac
                        **************************************************

A0A3Q2XQX2_BCL2-01      cattggcgcgtacctcacccagaagtga
A0A3Q2XQX2_BCL2-02      cattggcgcgtacctcacccagaagtga
                        ****************************

© 1998-2019