Dataset for CDS BCL-2-like of organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I2YML2_BCL2A1-      atgacagact----------gtgaatttggatatat--------------
A0A2I2YML2_BCL2A1-      atgacagact----------gtgaatttggatatat--------------
A0A2I2YML2_BCL2A1-      atgacagact----------gtgaatttggatatat--------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------atgtctcagagcaaccgggagctggtggtt
A0A2I2YPX6_BCL2L2-      atggcgaccc-----cagcctcggccccagacacacgggctctggtggca
A0A2I2YPX6_BCL2L2-      atggcgaccc-----cagcctcggccccagacacacgggctctggtggca
G3QLU6_BCL2L10-01       atggttgaccagtggcgggagcgcaccaccatggccga------------
G3QES9_BCL2-01          atggcgcacg--ctgggagaacagggtacgataaccgagagatagtgatg
A0A2I2YQH7_MCL1-02      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2I2YQH7_MCL1-01      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2I2YQH7_MCL1-03      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------

A0A2I2YML2_BCL2A1-      -----------ttacaggctagctcagga---------------------
A0A2I2YML2_BCL2A1-      -----------ttacaggctagctcagga---------------------
A0A2I2YML2_BCL2A1-      -----------ttacaggctagctcagga---------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        gactttctctcctataagctttcccagaaaggatacagctggagtcagtt
A0A2I2YPX6_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtc-----------
A0A2I2YPX6_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtc-----------
G3QLU6_BCL2L10-01       -----------------cccgctgcgggagcgcaccgagcggttgctggc
G3QES9_BCL2-01          aagtacatccattataagctgtcgcagaggggctacg---agtgggatgc
A0A2I2YQH7_MCL1-02      ------actcaacct---ctactgtgggggggc--cg---gcttgggggc
A0A2I2YQH7_MCL1-01      ------actcaacct---ctactgtgggggggc--cg---gcttgggggc
A0A2I2YQH7_MCL1-03      ------actcaacct---ctactgtgggggggc--cg---gcttgggggc

A0A2I2YML2_BCL2A1-      ---ctatctgca----------gtacgtcctacagat-------------
A0A2I2YML2_BCL2A1-      ---ctatctgca----------gtacgtcctacagat-------------
A0A2I2YML2_BCL2A1-      ---ctatctgca----------gtacgtcctacagat-------------
G3RY91_BCL2L1-02        -----atgtggaagagaacaggactgaggccccagaa-------------
G3RY91_BCL2L1-01        tagtgatgtggaagagaacaggactgaggccccagaa-------------
A0A2I2YPX6_BCL2L2-      ------tgtgga----------gct--ggccccgggg-------------
A0A2I2YPX6_BCL2L2-      ------tgtgga----------gct--ggccccgggg-------------
G3QLU6_BCL2L10-01       cgactacctggg----------gtactgcgcccgggaacccggcaccccc
G3QES9_BCL2-01          gggagatgtgggc---------gccgtgcccccgggggccgcccccgcac
A0A2I2YQH7_MCL1-02      cggcagcggcggc---------gccacccctccggga-------------
A0A2I2YQH7_MCL1-01      cggcagcggcggc---------gccacccctccggga-------------
A0A2I2YQH7_MCL1-03      cggcagcggcggc---------gccacccctccggga-------------
                                                        * *               

A0A2I2YML2_BCL2A1-      ----------------------------accacaacctgg----------
A0A2I2YML2_BCL2A1-      ----------------------------accacaacctgg----------
A0A2I2YML2_BCL2A1-      ----------------------------accacaacctgg----------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       gagccgacgcc-----------------gtccacgcccga----------
G3QES9_BCL2-01          cgggcatcttctc---------------ctcccagcccgg----------
A0A2I2YQH7_MCL1-02      -gggcgacttttagctacggagaaggaggcctcggcccggcgagagatag
A0A2I2YQH7_MCL1-01      -gggcgacttttagctacggagaaggaggcctcggcccggcgagagatag
A0A2I2YQH7_MCL1-03      -gggcgactttta-------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       -------------------------------ggccgccgtgctgcgctcc
G3QES9_BCL2-01          -----------------------------------------gcacacgcc
A0A2I2YQH7_MCL1-02      ggggaggggaggccggcgcggtgattggcggaagcgccggcgcaagcccc
A0A2I2YQH7_MCL1-01      ggggaggggaggccggcgcggtgattggcggaagcgccggcgcaagcccc
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------atcaggtccaagcaaaacgtccagagtgctacaaaa
A0A2I2YML2_BCL2A1-      --------------atcaggtccaagcaaaacgtccagagtgctacaaaa
A0A2I2YML2_BCL2A1-      --------------atcaggtccaagcaaaacgtccagagtgctacaaaa
G3RY91_BCL2L1-02        -----------------gggactgaatcggagatggagacccccag----
G3RY91_BCL2L1-01        -----------------gggactgaatcggagatggagacccccag----
A0A2I2YPX6_BCL2L2-      -----------------agggccca---gcagct---gacccgctg----
A0A2I2YPX6_BCL2L2-      -----------------agggccca---gcagct---gacccgctg----
G3QLU6_BCL2L10-01       gcggcc--------gccaggttacggcagattcaccggtccttctt----
G3QES9_BCL2-01          ccatccagccgcatcccgggacc-----gggtcgccaggacctcgc----
A0A2I2YQH7_MCL1-02      ccgtccaccctcacgccagactcccggagggtcgcgcggccgccgcccat
A0A2I2YQH7_MCL1-01      ccgtccaccctcacgccagactcccggagggtcgcgcggccgccgcccat
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      ggttgc----gttctcagtccaaaaagaag--------------------
A0A2I2YML2_BCL2A1-      ggttgc----gttctcagtccaaaaagaag--------------------
A0A2I2YML2_BCL2A1-      ggttgc----gttctcagtccaaaaagaag--------------------
G3RY91_BCL2L1-02        ---tgccatcaatggcaacccatcct------------------------
G3RY91_BCL2L1-01        ---tgccatcaatggcaacccatcctggcacctggcggacagccccgcgg
A0A2I2YPX6_BCL2L2-      ---cac---------caagccatgcgggca--------------------
A0A2I2YPX6_BCL2L2-      ---cac---------caagccatgcgggca--------------------
G3QLU6_BCL2L10-01       ---ctccgcctacctcggctaccccgggaa-----------ccgcttcga
G3QES9_BCL2-01          ---cgctgcagaccccggctgcccccggcg-----------ccgccgcgg
A0A2I2YQH7_MCL1-02      tggcgccgaggtccccgac-gtcaccgcga-----------cccccgcga
A0A2I2YQH7_MCL1-01      tggcgccgaggtccccgac-gtcaccgcga-----------cccccgcga
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        tgaatggagccactggccacagcagcagtttggatgcccggg--------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       g-----------ctg--------------gtggcgctgatgg--------
G3QES9_BCL2-01          ggc---------ctgcgctca------gcccggtgccacctg--------
A0A2I2YQH7_MCL1-02      ggctgcttttctttgcgcccacccgccgcgcggcgccgcttgaggagatg
A0A2I2YQH7_MCL1-01      ggctgcttttctttgcgcccacccgccgcgcggcgccgcttgaggagatg
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-02      gaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgg
A0A2I2YQH7_MCL1-01      gaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgg
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       -----------------------------cggattccgtgctct------
G3QES9_BCL2-01          -----------------------------tggtccacctgaccct-----
A0A2I2YQH7_MCL1-02      gtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctgg
A0A2I2YQH7_MCL1-01      gtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctgg
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-02      agttggtcggggaatctggtaatgacaccagtacggacgggtcactaccc
A0A2I2YQH7_MCL1-01      agttggtcggggaatctggtaatgacaccagtacggacgggtcactaccc
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        ---------aggtgatccccatggcagcagtaaagcaagcgctgagggag
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       ---------ccgacag----------------------------------
G3QES9_BCL2-01          ---------ccgccag----------------------------------
A0A2I2YQH7_MCL1-02      tcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtc
A0A2I2YQH7_MCL1-01      tcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtc
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --tggaaaagaatctga---------------------------------
A0A2I2YML2_BCL2A1-      --tggaaaagaatctga---------------------------------
A0A2I2YML2_BCL2A1-      --tggaaaagaatctga---------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        gcaggcgacgagtttga---------------------actgcggtaccg
A0A2I2YPX6_BCL2L2-      gctggagatgagttcga---------------------gacccgcttccg
A0A2I2YPX6_BCL2L2-      gctggagatgagttcga---------------------gacccgcttccg
G3QLU6_BCL2L10-01       ------------------------------------ccccggccccac--
G3QES9_BCL2-01          gccggcgacgacttctc---------------------ccgccgctaccg
A0A2I2YQH7_MCL1-02      gctggagattatctctcggtaccttcgggagcaggccaccggcgccaagg
A0A2I2YQH7_MCL1-01      gctggagattatctctcggtaccttcgggagcaggccaccggcgccaagg
A0A2I2YQH7_MCL1-03      ----------------------------------gccaccggcgccaagg

A0A2I2YML2_BCL2A1-      ------------------agtcatgcttggacaatgttaatgt-tgtgtc
A0A2I2YML2_BCL2A1-      ------------------agtcatgcttggacaatgttaatgt-tgtgtc
A0A2I2YML2_BCL2A1-      ------------------agtcatgcttggacaatgttaatgt-tgtgtc
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        gcgggcattcagtgac-----------ctgacatcccagctccacatcac
A0A2I2YPX6_BCL2L2-      gcgcaccttctctgat-----------ctggcggctcagctgcatgtgac
A0A2I2YPX6_BCL2L2-      gcgcaccttctctgat-----------ctggcggctcagctgcatgtgac
G3QLU6_BCL2L10-01       ---------------------ctggggcag--agtggtgacgctcgtga-
G3QES9_BCL2-01          ccgcgacttcgccgag-atgtc-----cagccagc-----tgcacctgac
A0A2I2YQH7_MCL1-02      acacaaagccaatgggcaggtctggggcaaccagcaggaaggcgctggag
A0A2I2YQH7_MCL1-01      acacaaagccaatgggcaggtctggggcaaccagcaggaaggcgctggag
A0A2I2YQH7_MCL1-03      acacaaagccaatgggcaggtctggggcaaccagcaggaaggcgctggag

A0A2I2YML2_BCL2A1-      catagacactgcc---agaacactgttcaaccaagtgatggaaaaggagt
A0A2I2YML2_BCL2A1-      catagacactgcc---agaacactgttcaaccaagtgatggaaaaggagt
A0A2I2YML2_BCL2A1-      catagacactgcc---agaacactgttcaaccaagtgatggaaaaggagt
G3RY91_BCL2L1-02        ----gggacagca-tatcagagctttga--acaggtagtgaatgaactct
G3RY91_BCL2L1-01        cccagggacagca-tatcagagctttga--acaggtagtgaatgaactct
A0A2I2YPX6_BCL2L2-      cccaggctcagcc-caacaacgcttcac--ccaggtctccgatgaacttt
A0A2I2YPX6_BCL2L2-      cccaggctcagcc-caacaacgcttcac--ccaggtctccgatgaacttt
G3QLU6_BCL2L10-01       --ccttcg------cagggacgctgc---------tggagagagggccgc
G3QES9_BCL2-01          gcccttcaccgcg-cggggacgctttgc--cacggtggtggaggagctct
A0A2I2YQH7_MCL1-02      accttacgacgggttggggatggcgtgcagcgcaaccacgagacggcctt
A0A2I2YQH7_MCL1-01      accttacgacgggttggggatggcgtgcagcgcaaccacgagacggcctt
A0A2I2YQH7_MCL1-03      accttacgacgggttggggatggcgtgcagcgcaaccacgagacggcctt

A0A2I2YML2_BCL2A1-      ttgaa---------------------------------------------
A0A2I2YML2_BCL2A1-      ttgaa---------------------------------------------
A0A2I2YML2_BCL2A1-      ttgaa---------------------------------------------
G3RY91_BCL2L1-02        tccgg---------------------------------------------
G3RY91_BCL2L1-01        tccgg---------------------------------------------
A0A2I2YPX6_BCL2L2-      ttcaa---------------------------------------------
A0A2I2YPX6_BCL2L2-      ttcaa---------------------------------------------
G3QLU6_BCL2L10-01       tggtg---------------------------------------------
G3QES9_BCL2-01          tcagg---------------------------------------------
A0A2I2YQH7_MCL1-02      ccaa----------------------------------------------
A0A2I2YQH7_MCL1-01      ccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaat
A0A2I2YQH7_MCL1-03      ccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaat

A0A2I2YML2_BCL2A1-      --------------------------------gacggcatcattaactgg
A0A2I2YML2_BCL2A1-      --------------------------------gacggcatcattaactgg
A0A2I2YML2_BCL2A1-      --------------------------------gacggcatcattaactgg
G3RY91_BCL2L1-02        -----------------------------------gatggggtaaactgg
G3RY91_BCL2L1-01        -----------------------------------gatggggtaaactgg
A0A2I2YPX6_BCL2L2-      -----------------------------------gggggccccaactgg
A0A2I2YPX6_BCL2L2-      -----------------------------------gggggccccaactgg
G3QLU6_BCL2L10-01       ----------------------------------------accgcccggt
G3QES9_BCL2-01          -----------------------------------gacggggtgaactgg
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-01      cgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactgg
A0A2I2YQH7_MCL1-03      cgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactgg

A0A2I2YML2_BCL2A1-      ggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaact
A0A2I2YML2_BCL2A1-      ggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaact
A0A2I2YML2_BCL2A1-      ggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaact
G3RY91_BCL2L1-02        ggtcgcattgtggcctttttctccttcgg------cggggcac----tgt
G3RY91_BCL2L1-01        ggtcgcattgtggcctttttctccttcgg------cggggcac----tgt
A0A2I2YPX6_BCL2L2-      ggccgccttgtagccttctttgtctttgg------ggctgcac----tgt
A0A2I2YPX6_BCL2L2-      ggccgccttgtagccttctttgtctttgg------ggctgcac----tgt
G3QLU6_BCL2L10-01       ggaagaagtggggcttccagc--------------cgcggctaaaggagc
G3QES9_BCL2-01          gggaggattgtggccttctttgagttcgg------tggggtca----tgt
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-01      ggcaggattgtgactctcatttcttttggtgcctttgtggcta----aac
A0A2I2YQH7_MCL1-03      ggcaggattgtgactctcatttcttttggtgcctttgtggcta----aac

A0A2I2YML2_BCL2A1-      tctacgacagcaaattgccccggatgtgg--------atacttataagga
A0A2I2YML2_BCL2A1-      tctacgacagcaaattgccccggatgtgg--------atacttataagga
A0A2I2YML2_BCL2A1-      tctacgacagcaaattgccccggatgtgg--------atacttataagga
G3RY91_BCL2L1-02        gcgtggaaagc--gtagacaaggagatgcag------gtattggtgagtc
G3RY91_BCL2L1-01        gcgtggaaagc--gtagacaaggagatgcag------gtattggtgagtc
A0A2I2YPX6_BCL2L2-      gtgctgagagt--gtcaacaaggagatggaa------ccactggtgggac
A0A2I2YPX6_BCL2L2-      gtgctgagagt--gtcaacaaggagatggaa------ccactggtgggac
G3QLU6_BCL2L10-01       aggagggcgac--gtcgcccggga-------------ctgccagcg----
G3QES9_BCL2-01          gtgtggagagc--gtcaaccgggagatgtct------cccctggtggaca
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-01      acttgaagacc--ataaaccaagaaagctgcatcgaaccattagcagaaa
A0A2I2YQH7_MCL1-03      acttgaagacc--ataaaccaagaaagctgcatcgaaccattagcagaaa

A0A2I2YML2_BCL2A1-      gatttca---------tattttgtt--------gcggagttcataatgaa
A0A2I2YML2_BCL2A1-      gatttca---------tattttgtt--------gcggagttcataatgaa
A0A2I2YML2_BCL2A1-      gatttca---------tattttgtt--------gcggagttcataatgaa
G3RY91_BCL2L1-02        ggatcgc---------agcttggat-------ggccacttacctgaatga
G3RY91_BCL2L1-01        ggatcgc---------agcttggat-------ggccacttacctgaatga
A0A2I2YPX6_BCL2L2-      aagtgca---------ggagtggat-------ggtggcctacctggagac
A0A2I2YPX6_BCL2L2-      aagtgca---------ggagtggat-------ggtggcctacctggagac
G3QLU6_BCL2L10-01       ----------------cctggtggccttgctgagctcg-cggctcatggg
G3QES9_BCL2-01          acatcgc---------cctgtggat-------gactgagtacctgaaccg
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-01      gtatcacagacgttctcgtaaggacaaaacgggactggctagttaaac--
A0A2I2YQH7_MCL1-03      gtatcacagacgttctcgtaaggacaaaacgggactggctagttaaac--

A0A2I2YML2_BCL2A1-      taacacaggagaatggataaggcaaaacggaggctggggga---aatggc
A0A2I2YML2_BCL2A1-      taacacaggagaatggataaggcaaaacggaggct-gggaa---aatggc
A0A2I2YML2_BCL2A1-      taacacaggagaatggataaggcaaaacggaggct-gggaa---aatggc
G3RY91_BCL2L1-02        ccacctagagccttggatccaggagaacggcggct-gggat------act
G3RY91_BCL2L1-01        ccacctagagccttggatccaggagaacggcggct-gggat------act
A0A2I2YPX6_BCL2L2-      gcggctggctgactggatccacagcagtgggggct-gggagctggaagct
A0A2I2YPX6_BCL2L2-      gcggctggctgactggatccacagcagtgggggct-gggcg------gag
G3QLU6_BCL2L10-01       gcagcaccgcgcctggctgcaggctcagggcggct-gggat------ggc
G3QES9_BCL2-01          gcacctgcacacctggatccaggataacggaggct-gggat------gcc
A0A2I2YQH7_MCL1-02      -------------------------------------ggat------ggg
A0A2I2YQH7_MCL1-01      --------------------------aaagaggct-gggat------ggg
A0A2I2YQH7_MCL1-03      --------------------------aaagaggct-gggat------ggg

A0A2I2YML2_BCL2A1-      -------acaatcacacgcctatg-c----------------tggtagag
A0A2I2YML2_BCL2A1-      tttgtaaagaagtttgaacctaaatc----------------tggctgga
A0A2I2YML2_BCL2A1-      tttgtaaagaagtttgaacctaaatc----------------tggctgga
G3RY91_BCL2L1-02        tttgtggaactctatgggaacaatgc------agcagccgagagccgaaa
G3RY91_BCL2L1-01        tttgtggaactctatgggaacaatgc------agcagccgagagccgaaa
A0A2I2YPX6_BCL2L2-      atcaaagctcgagtcagggagatgga---ggaagaagctgagaagctaaa
A0A2I2YPX6_BCL2L2-      ttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcg
G3QLU6_BCL2L10-01       ttttgtcacttcttc----------------------------------a
G3QES9_BCL2-01          tttgtggaactgtac-----------------------------------
A0A2I2YQH7_MCL1-02      tttgtggagttcttc---------------------------catgtaga
A0A2I2YQH7_MCL1-01      tttgtggagttcttc---------------------------catgtaga
A0A2I2YQH7_MCL1-03      tttgtggagttcttc---------------------------catgtaga

A0A2I2YML2_BCL2A1-      tcagtggcccacaagaagaggaaaatggc---------------------
A0A2I2YML2_BCL2A1-      tgacttttctagaagttacgggaaagatc---------------------
A0A2I2YML2_BCL2A1-      tgacttttctagaagttacgggaaagatctcaatactgttgaccagaaag
G3RY91_BCL2L1-02        gggcc--------------aggaacgcttcaaccgctgg------ttcct
G3RY91_BCL2L1-01        gggcc--------------aggaacgcttcaaccgctgg------ttcct
A0A2I2YPX6_BCL2L2-      ggagctacagaacgaggtagagaagcagatgaatatgagtc-cacctcca
A0A2I2YPX6_BCL2L2-      ggag---------------gggaactgggcatcagtgag-----------
G3QLU6_BCL2L10-01       ggacccc---------------------ctttccgctggct-ttttggag
G3QES9_BCL2-01          ggccccagcatgcggcctctg---tttgatttctcctggctgtctctgaa
A0A2I2YQH7_MCL1-02      ggacctagaaggtggcatcaggaatgtg----ctgctggct---tttgca
A0A2I2YQH7_MCL1-01      ggacctagaaggtggcatcaggaatgtg----ctgctggct---tttgca
A0A2I2YQH7_MCL1-03      ggacctagaaggtggcatcaggaatgtg----ctgctggct---tttgca

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      gacactcca-----------------------------------------
G3RY91_BCL2L1-02        gacgggcat-----------------------------gactgtggccgg
G3RY91_BCL2L1-01        gacgggcat-----------------------------gactgtggccgg
A0A2I2YPX6_BCL2L2-      ggcaatgctggaccagtgatcatgtccattgaggagaagatggaggctga
A0A2I2YPX6_BCL2L2-      gacagtgct-----------------------------gacgggggccg-
G3QLU6_BCL2L10-01       aaaacagct-----------------------------ggtccaggcttt
G3QES9_BCL2-01          gactctgct-----------------------------cagtttggc---
A0A2I2YQH7_MCL1-02      ggtgttgct-----------------------------ggagtagga---
A0A2I2YQH7_MCL1-01      ggtgttgct-----------------------------ggagtagga---
A0A2I2YQH7_MCL1-03      ggtgttgct-----------------------------ggagtagga---

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      ---------------------tgtgaaat---gctatctctcct------
A0A2I2YML2_BCL2A1-      ------------------tattgtgaaaccggcctaatttttctgactg-
G3RY91_BCL2L1-02        cg----------------tgg-------ttctgctgggctcact------
G3RY91_BCL2L1-01        cg----------------tgg-------ttctgctgggctcact------
A0A2I2YPX6_BCL2L2-      tgcccgttccatctatgttgg-------caatgtggactatggtgcaaca
A0A2I2YPX6_BCL2L2-      ------------------tgg-------cactgggggccctggt------
G3QLU6_BCL2L10-01       tctgtcatgc--------ttgt------tagcaacagccttcatttatc-
G3QES9_BCL2-01          --------cc--------tggtgggagcttgcatcaccctgggtgccta-
A0A2I2YQH7_MCL1-02      --------gc--------tggt------ttg-------------gcata-
A0A2I2YQH7_MCL1-01      --------gc--------tggt------ttg-------------gcata-
A0A2I2YQH7_MCL1-03      --------gc--------tggt------ttg-------------gcata-

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      gcagaagagctggaagctcactttcatggctgtggttcagtcaaccgtgt
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      taccatactctgtgacaaatttagtggccatcccaaagggtttgcatata
A0A2I2YPX6_BCL2L2-      ----------------aactgtaggggcctt-------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      tagagttctcagacaaagagtcagtgaggacttccttggccttagatgag
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      tccctatttagaggaaggcaaatcaaggttgactttaaggctatcatttg
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      ttcatctctgactcaggtgatcccaaaacgaaccaacagaccaggcatca
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      gcacaacagaccggggttttccacgagcccgctaccgcgcccggaccacc
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      ----------------------------------------gaagcaa---
A0A2I2YML2_BCL2A1-      -----------------------------------ttatggaaacgat--
G3RY91_BCL2L1-02        -----------------------------------cttcagtcggaaa--
G3RY91_BCL2L1-01        -----------------------------------cttcagtcggaaa--
A0A2I2YPX6_BCL2L2-      aactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
A0A2I2YPX6_BCL2L2-      -----------------------------------ttttgctagcaag--
G3QLU6_BCL2L10-01       -----------------------------------tctg--------g--
G3QES9_BCL2-01          -----------------------------------tctgggccacaag--
A0A2I2YQH7_MCL1-02      -----------------------------------tcta----ataag--
A0A2I2YQH7_MCL1-01      -----------------------------------tcta----ataag--
A0A2I2YQH7_MCL1-03      -----------------------------------tcta----ataag--

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      -------------------------------------------------t
A0A2I2YML2_BCL2A1-      ---------------------------------tgccaacacatacttct
G3RY91_BCL2L1-02        --------------------------------------------------
G3RY91_BCL2L1-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      ccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccc
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-02      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------

A0A2I2YML2_BCL2A1-      -tttgtaa------------
A0A2I2YML2_BCL2A1-      actgttga------------
A0A2I2YML2_BCL2A1-      acttttaa------------
G3RY91_BCL2L1-02        -----tga------------
G3RY91_BCL2L1-01        -----tga------------
A0A2I2YPX6_BCL2L2-      cttactaa------------
A0A2I2YPX6_BCL2L2-      -----tga------------
G3QLU6_BCL2L10-01       -----acacgattattatga
G3QES9_BCL2-01          -----tga------------
A0A2I2YQH7_MCL1-02      -----atagccttactgtaa
A0A2I2YQH7_MCL1-01      -----atag-----------
A0A2I2YQH7_MCL1-03      -----atag-----------

© 1998-2019