Dataset for CDS BCL2L1 of organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3RY91_BCL2L1-02      --------------------------------------------------
G3RY91_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctataagct

G3RY91_BCL2L1-02      -----------------------------------atgtggaagagaaca
G3RY91_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca

G3RY91_BCL2L1-02      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
G3RY91_BCL2L1-01      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc

G3RY91_BCL2L1-02      atcaatggcaacccatcct-------------------------------
G3RY91_BCL2L1-01      atcaatggcaacccatcctggcacctggcggacagccccgcggtgaatgg

G3RY91_BCL2L1-02      --------------------------------------------------
G3RY91_BCL2L1-01      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg

G3RY91_BCL2L1-02      --------------------------------------------------
G3RY91_BCL2L1-01      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg

G3RY91_BCL2L1-02      ------------------------------------------------gg
G3RY91_BCL2L1-01      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg

G3RY91_BCL2L1-02      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
G3RY91_BCL2L1-01      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg

G3RY91_BCL2L1-02      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
G3RY91_BCL2L1-01      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg

G3RY91_BCL2L1-02      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
G3RY91_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc

G3RY91_BCL2L1-02      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
G3RY91_BCL2L1-01      agcttggatggccacttacctgaatgaccacctagagccttggatccagg

G3RY91_BCL2L1-02      agaacggcggctgggatacttttgtggaactctatgggaacaatgcagca
G3RY91_BCL2L1-01      agaacggcggctgggatacttttgtggaactctatgggaacaatgcagca

G3RY91_BCL2L1-02      gccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacggg
G3RY91_BCL2L1-01      gccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacggg

G3RY91_BCL2L1-02      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
G3RY91_BCL2L1-01      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat

G3RY91_BCL2L1-02      ga
G3RY91_BCL2L1-01      ga

© 1998-2019