Dataset for CDS BCL2A1 of organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I2YML2_BCL2A1-      atgacagactgtgaatttggatatatttacaggctagctcaggactatct
A0A2I2YML2_BCL2A1-      atgacagactgtgaatttggatatatttacaggctagctcaggactatct
A0A2I2YML2_BCL2A1-      atgacagactgtgaatttggatatatttacaggctagctcaggactatct
                        **************************************************

A0A2I2YML2_BCL2A1-      gcagtacgtcctacagataccacaacctggatcaggtccaagcaaaacgt
A0A2I2YML2_BCL2A1-      gcagtacgtcctacagataccacaacctggatcaggtccaagcaaaacgt
A0A2I2YML2_BCL2A1-      gcagtacgtcctacagataccacaacctggatcaggtccaagcaaaacgt
                        **************************************************

A0A2I2YML2_BCL2A1-      ccagagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaag
A0A2I2YML2_BCL2A1-      ccagagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaag
A0A2I2YML2_BCL2A1-      ccagagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaag
                        **************************************************

A0A2I2YML2_BCL2A1-      aatctgaagtcatgcttggacaatgttaatgttgtgtccatagacactgc
A0A2I2YML2_BCL2A1-      aatctgaagtcatgcttggacaatgttaatgttgtgtccatagacactgc
A0A2I2YML2_BCL2A1-      aatctgaagtcatgcttggacaatgttaatgttgtgtccatagacactgc
                        **************************************************

A0A2I2YML2_BCL2A1-      cagaacactgttcaaccaagtgatggaaaaggagtttgaagacggcatca
A0A2I2YML2_BCL2A1-      cagaacactgttcaaccaagtgatggaaaaggagtttgaagacggcatca
A0A2I2YML2_BCL2A1-      cagaacactgttcaaccaagtgatggaaaaggagtttgaagacggcatca
                        **************************************************

A0A2I2YML2_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2I2YML2_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2I2YML2_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
                        **************************************************

A0A2I2YML2_BCL2A1-      aagaaacttctacgacagcaaattgccccggatgtggatacttataagga
A0A2I2YML2_BCL2A1-      aagaaacttctacgacagcaaattgccccggatgtggatacttataagga
A0A2I2YML2_BCL2A1-      aagaaacttctacgacagcaaattgccccggatgtggatacttataagga
                        **************************************************

A0A2I2YML2_BCL2A1-      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga
A0A2I2YML2_BCL2A1-      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga
A0A2I2YML2_BCL2A1-      gatttcatattttgttgcggagttcataatgaataacacaggagaatgga
                        **************************************************

A0A2I2YML2_BCL2A1-      taaggcaaaacggaggctgggggaaatggc-------acaatcacacgcc
A0A2I2YML2_BCL2A1-      taaggcaaaacggaggct-gggaaaatggctttgtaaagaagtttgaacc
A0A2I2YML2_BCL2A1-      taaggcaaaacggaggct-gggaaaatggctttgtaaagaagtttgaacc
                        ****************** *** *******       * **       **

A0A2I2YML2_BCL2A1-      tatg-ctggtagagtcagtggcccacaagaagaggaaaatggc-------
A0A2I2YML2_BCL2A1-      taaatctggctggatgacttttctagaagttacgggaaagatctcaatac
A0A2I2YML2_BCL2A1-      taaatctggctggatgacttttctagaagttacgggaaagatc-------
                        **   ****  *  * * *   * * ***    ** ***   *       

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      tgttgaccagaaaggacactccatattgtgaaaccggcctaatttttctg
A0A2I2YML2_BCL2A1-      --------------------------tgtgaaat---gctatctctcct-
                                                                          

A0A2I2YML2_BCL2A1-      -----------------------------------tttgtaa
A0A2I2YML2_BCL2A1-      actgttatggaaacgattgccaacacatacttctacttttaa
A0A2I2YML2_BCL2A1-      ---------gaagcaa-----------------tactgttga
                                                            *  * *

© 1998-2018