Dataset for CDS BCL-2-like of organism Gopherus agassizii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452J3N6_BCL2A1-      atgg-------------------------------------aaagctc--
A0A452I9V7_BCL2-01      atgtatttaactgcatgtgtctgtacgttgcactggagggaaaagcacag
A0A452ILL8_BCL2L1-      atgt-------------------------------------cgaacac--
A0A452ILL8_BCL2L1-      atgt-------------------------------------cgaacac--
                        ***                                        * * *  

A0A452J3N6_BCL2A1-      ---------------------tgagtactgctatgtttact---atttag
A0A452I9V7_BCL2-01      tacttctgcaagagcttggagtcaaagaggctatgataaccgggagatag
A0A452ILL8_BCL2L1-      ------------------------------------taacagggaattag
A0A452ILL8_BCL2L1-      ------------------------------------taacagggaattag
                                                            * **    *  ***

A0A452J3N6_BCL2A1-      tccaagattatctgaaatacgttcttc-----aggaaccacagct-----
A0A452I9V7_BCL2-01      tgctgaagtacatccattacaaactgtcacagaggggatatgattgggct
A0A452ILL8_BCL2L1-      tgattgactttctctcctacaagctatcgcagaggggatacagctggagt
A0A452ILL8_BCL2L1-      tgattgactttctctcctacaagctatcgcagaggggatacagctggagt
                        *     * *   *    ***   **       ***    *    *     

A0A452J3N6_BCL2A1-      --------------------------tggaccagccccaagcaga-----
A0A452I9V7_BCL2-01      ------------gccaatgaaaacagaggaccagtttc--accaaatctc
A0A452ILL8_BCL2L1-      cggttcgaaggggaggatgagatc--aggactgattct--gcagaa----
A0A452ILL8_BCL2L1-      cggttcgaaggggaggatgagatc--aggactgattct--gcagaa----
                                                   ****          *  *     

A0A452J3N6_BCL2A1-      ------------gttgctcatgtcttaagacacgct--------------
A0A452I9V7_BCL2-01      tctccccctactgttactgggacctcatctgaccatgctgggctgatgtc
A0A452ILL8_BCL2L1-      ------------gaggctgagatggcaagtgtccctaatgggagtccatc
A0A452ILL8_BCL2L1-      ------------gaggctgagatggcaagtgtccctaatgggagtccatc
                                    *   **        *     *  *              

A0A452J3N6_BCL2A1-      ---gcatcct--------------------------ttctgcaaaaggaa
A0A452I9V7_BCL2-01      tctgcctcctg-----agccccctggctc----ggctgctg---ctagta
A0A452ILL8_BCL2L1-      ctggcatccgggtgccagccacatagtgaatggggctgctgggcacagta
A0A452ILL8_BCL2L1-      ctggcatccgggtgccagccacatagtgaatggggctgctgggcacagta
                           ** ***                           * ***      * *

A0A452J3N6_BCL2A1-      a-----------------atgaagagagtctgaaacc-------------
A0A452I9V7_BCL2-01      acgtgccccttggtg---atgggctgcgcccagcaccgcaggctgttctc
A0A452ILL8_BCL2L1-      acag---ccttgaagcccatgaaagggttccagcaactggagtgaggc--
A0A452ILL8_BCL2L1-      acag---ccttgaagcccatgaaagggttccagcaactggagtgaggc--
                        *                 ***    *   *    * *             

A0A452J3N6_BCL2A1-      ---atgtttggacacatttgatattacctctgtagatgctgccagaagaa
A0A452I9V7_BCL2-01      ttggctctgtgccaagctggagatgaattttcccgtcgctaccacagaga
A0A452ILL8_BCL2L1-      -aggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggc
A0A452ILL8_BCL2L1-      -aggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggc
                               *  *  *     ** ** *  *        * *  *  *    

A0A452J3N6_BCL2A1-      ttt--------------------------tcactcaagtcatggataa--
A0A452I9V7_BCL2-01      ttttgcccagatgtctggccagctgcacttgaccccattcacggccaggg
A0A452ILL8_BCL2L1-      tttcagtgacctcacttcccaactccacatcactcctggcacggcatacc
A0A452ILL8_BCL2L1-      tttcagtgacctcacttcccaactccacatcactcctggcacggcatacc
                        ***                          * ** *    ** **      

A0A452J3N6_BCL2A1-      agaattt------gctgatggaaacact----------------aactgg
A0A452I9V7_BCL2-01      ggcgctttgtggcggtggtggaggagctgttccgagatggggttaactgg
A0A452ILL8_BCL2L1-      agagctttgagcaggtagtgaatgaactcttccgggacggagtgaactgg
A0A452ILL8_BCL2L1-      agagctttgagcaggtagtgaatgaactcttccgggacggagtgaactgg
                         *   **      * *  ** *    **                ******

A0A452J3N6_BCL2A1-      ggacggattttgacaatatttatgtttggaggaattctttctaagaagct
A0A452I9V7_BCL2-01      ggaaggatcgtggccttctttgaatttggtggtgtgatgtgtgtggagag
A0A452ILL8_BCL2L1-      gggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagag
A0A452ILL8_BCL2L1-      gggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagag
                        **  * **  ** *  * **    ***** **     * * *  * **  

A0A452J3N6_BCL2A1-      tcaagaacacagagttcagcttacaggagaaaataaaaagcagatttctt
A0A452I9V7_BCL2-01      cgttaatcgggagatgtcgcctcttgtggacagc---------attgctg
A0A452ILL8_BCL2L1-      tgtcgacaaggagatgcaggtgttggttggacgc---------atcgtct
A0A452ILL8_BCL2L1-      tgtcgacaaggagatgcaggtgttggttggacgc---------atcgtct
                             *        *   *      *  *              **     

A0A452J3N6_BCL2A1-      atttcatcacagagtacatta-taaacaccaaggctgagtggatagaggc
A0A452I9V7_BCL2-01      tgtggatgactgaatacctgaacagacacctacaca-actggatccagga
A0A452ILL8_BCL2L1-      catggatgaccacttacctgactgaccacctagatc-cctggatccaaga
A0A452ILL8_BCL2L1-      catggatgaccacttacctgactgaccacctagatc-cctggatccaaga
                          *  ** **    *** * *     **** *       *****  * * 

A0A452J3N6_BCL2A1-      aaatggaggttgggaa-----aatggcttccta----------------a
A0A452I9V7_BCL2-01      caacggaggctggg-------tatgtgtcc--------------------
A0A452ILL8_BCL2L1-      gaatggcggttgggagcggtttgtggatctctatgggaatgacgctgctg
A0A452ILL8_BCL2L1-      gaatggcggttgggagcggtttgtggatctctatgggaatgacgctgctg
                         ** ** ** ****         **  *                      

A0A452J3N6_BCL2A1-      ctatgtttgaggaaaaacgatcatggctgtccttattcaatattaaagca
A0A452I9V7_BCL2-01      --------------------------------------------------
A0A452ILL8_BCL2L1-      ccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccggg
A0A452ILL8_BCL2L1-      ccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccggg
                                                                          

A0A452J3N6_BCL2A1-      aaaatcatg-----gatgctttt-------tccttcttcagtcagtacta
A0A452I9V7_BCL2-01      --------------agtatttct------ttctct-ttaaatt---ac-a
A0A452ILL8_BCL2L1-      gcgactctggcaggagtgctcctgctgggctctctgctgagcc---gcaa
A0A452ILL8_BCL2L1-      gcgactctggcaggagtgctcctgctgggctctctgctgagcc---gcaa
                                        *  *  *       **  *  * *       * *

A0A452J3N6_BCL2A1-      ttga
A0A452I9V7_BCL2-01      gtaa
A0A452ILL8_BCL2L1-      gtaa
A0A452ILL8_BCL2L1-      gtaa
                         * *

© 1998-2019