Dataset for CDS BCL-2-like of organism Gasterosteus aculeatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3P7B4_BCL2L1-01      atggcgaacattaacag---ggagctggtggagttcttcctaagc-----
G3NJY1_BCL2L1-01      atgtct-caaaacagag-----aactggtggttttctacataaac-----
G3PJT0_MCL1-01        atgaatataattcagagaccgaaactggccgcgttaaacatgaccggagt
                      ***      *   * **     * ****  *  **   * * * *     

G3P7B4_BCL2L1-01      tacaagc--------tgtctc---agaagaa----ccacccaacctc---
G3NJY1_BCL2L1-01      tataaac--------tctccc---agaggaacttacccctcaaccac---
G3PJT0_MCL1-01        catgagctgcattattctccctcaaaatggagtcgcgcccatgcgacagc
                       *  * *        * ** *   * * * *    *  *    *  *   

G3P7B4_BCL2L1-01      ----------tctgttgagg---ccggaggatgccggcggaaggacggag
G3NJY1_BCL2L1-01      -----atagggctgtccgagcctcccaacaggactggcgggggggtagag
G3PJT0_MCL1-01        tcgcaatgggctcggcgaaggactcccacaacggcaacgcggggacaaac
                                   *     *    *  *         **   **    * 

G3P7B4_BCL2L1-01      g-----gagacaaggccaa-----ctcggcgtccgttcctggac------
G3NJY1_BCL2L1-01      g-----caggggcggct------------ggtgggcagcgggga--gcga
G3PJT0_MCL1-01        gacaccccgaagcggcccagcgccctcggggtgaactccgcgaacggcta
                      *       *    ***              **      *  *        

G3P7B4_BCL2L1-01      ---------------gcgggag-----------------cagcgccggcc
G3NJY1_BCL2L1-01      cgc------actccaacggg--------------actttcaacggcacga
G3PJT0_MCL1-01        cccatcaaaaccgcagcgggaggacagcgaggacaccgacaacgactcgc
                                      ****                   ** ** *    

G3P7B4_BCL2L1-01      agccggggatgtcg----------tcgccaccgccgccaccg----tccg
G3NJY1_BCL2L1-01      gtcccgggaccccg----------------ccggcgtccccgctgctcca
G3PJT0_MCL1-01        tgccgtgcaccccggagtcggacagcgaaaccgacgtctccgactccccg
                        **  * *   **                *** ** * ***     ** 

G3P7B4_BCL2L1-01      gtgaca----------ccgaggccg-------------------------
G3NJY1_BCL2L1-01      gcaacggtcgccg---tcgacggcga-----------------------g
G3PJT0_MCL1-01        gcgggggccgcggctctggagagcgacacgaggcaactcctcggccgctt
                      *                 **   **                         

G3P7B4_BCL2L1-01      --------------------taaaggcagctcttcaggactctgcgaatg
G3NJY1_BCL2L1-01      cctgga------tgcgg---tgaaggaggccctgcgggactcggccaacg
G3PJT0_MCL1-01        cctgagagaatttacgggactgtcgaaaacccagtggaacccgagcaggg
                                          *   *    * *    * ** *    *  *

G3P7B4_BCL2L1-01      agttt---------------gagctgctcttcacgcaa------------
G3NJY1_BCL2L1-01      agttc---------------gagctgcgatacgctcgg------------
G3PJT0_MCL1-01        agctcaccaccatgaagagggtggtgggcgacgttttggagaagcacaga
                      ** *                * * **     *                  

G3P7B4_BCL2L1-01      ---gcgttcagtgacctctccttgcagctagacgtcac--ccccgacacg
G3NJY1_BCL2L1-01      ---gccttcagcgatctgcacaaccagctgcacatcac--gccggccacg
G3PJT0_MCL1-01        tacgtattcaatggtatggtgaacaaattg----tcactggacgaccgag
                         *  ****  *   *        *  *     ****    *   *  *

G3P7B4_BCL2L1-01      gc--ctaccacagcttcaagagcgtgatgg--acgaggtgttcaa-ggat
G3NJY1_BCL2L1-01      gc--ctaccagagcttcgaggacgtgatgg--acgaggtgttccg-ggac
G3PJT0_MCL1-01        gcgacgacgccagtttcgtgcgggaggtcgccacgagcctcttcgcggac
                      **  * **   ** ***  *   * * * *  *****    *    *** 

G3P7B4_BCL2L1-01      ggcgtc---aactggggccgcgtggtgggcctgtttgccttcggcggcgt
G3NJY1_BCL2L1-01      ggcgtc---aactggggccgcatcgtggggctgttcgccttcggcggggc
G3PJT0_MCL1-01        ggcaccacgaactggggccgcatcgccagcctggtggccttcggggcggt
                      ***  *   ************ * *   * *** * ******** *  * 

G3P7B4_BCL2L1-01      gctc---------------------------------tgcgtggagtgcg
G3NJY1_BCL2L1-01      gctg---------------------------------tgcgtggagtgcg
G3PJT0_MCL1-01        ggtgtgccaacacctggcggagcgaggccgggggaactgcgtggagctgg
                      * *                                  *********   *

G3P7B4_BCL2L1-01      tagagaaggacat------gaccgagctggtgt----cccgcatcg----
G3NJY1_BCL2L1-01      tggacaaggagat------gagtccgctggtgg----gcaggatcg----
G3PJT0_MCL1-01        tggggcaggagatctcggcctacctgctgtcggaccagcgggactggctg
                      * *   **** **            ****  *      * * *  *    

G3P7B4_BCL2L1-01      --------------------------------------cggactggatga
G3NJY1_BCL2L1-01      --------------------------------------tcgagtggatga
G3PJT0_MCL1-01        atcaaaaacaacgcctgggttggcttcgttgagttctttcgagtagcaga
                                                              ** * *  **

G3P7B4_BCL2L1-01      cca----cgtacctggacgagcacatcagtgcttggatccagagccaggg
G3NJY1_BCL2L1-01      cgc----tctacctggacaaccacattca---------------------
G3PJT0_MCL1-01        cccagagtctgcggtgaggaacactctcatggctgtggctggattcgcta
                      *        * *   **  * ***                          

G3P7B4_BCL2L1-01      aggatgggact------gttttgctgacattttcgggcgggacggcgcgg
G3NJY1_BCL2L1-01      -----------------gccctg---------------------------
G3PJT0_MCL1-01        gtattggggcgacactggccctgttgatcagtggaccttcaaaagtgcaa
                                       *   **                           

G3P7B4_BCL2L1-01      cagcggc-----------------gaggagatctcagg-----agacgat
G3NJY1_BCL2L1-01      -----------------------------gatc---------cagaacca
G3PJT0_MCL1-01        aggcagcttctcaccattgaattgttgcagatcgtgcgctctcagagggg
                                                   ****          ***    

G3P7B4_BCL2L1-01      gagaaggtggctgctcgtcggggtggcgctgctaatgggagtgctcgtcg
G3NJY1_BCL2L1-01      ggga----ggctg-------gcgt--------------------tcagac
G3PJT0_MCL1-01        aggacaccggctg-----cagcgtgatgtgagcaccagaccttctccgac
                        **    *****       * **                    **    

G3P7B4_BCL2L1-01      gtatggtcatggtcaagaagcggtga
G3NJY1_BCL2L1-01      atttga--------------------
G3PJT0_MCL1-01        atccggctctggacta----------
                       *  *                     

© 1998-2018