Dataset for CDS MCL-1 of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1L1RNM6_MCL1-01      atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcgg
A0A1L1RNM6_MCL1-02      atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcgg
A0A1D5PQZ2_MCL1-01      --------------------------------------------------

A0A1L1RNM6_MCL1-01      cggaggaagcccgggcctggtgcccgcttcaccagcaggagagcaaaccc
A0A1L1RNM6_MCL1-02      cggaggaagcccgggcctggtgcccgcttcaccagcaggagagcaaaccc
A0A1D5PQZ2_MCL1-01      --------------------------------------------------

A0A1L1RNM6_MCL1-01      cgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgag
A0A1L1RNM6_MCL1-02      cgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgag
A0A1D5PQZ2_MCL1-01      --------------------------------------------------

A0A1L1RNM6_MCL1-01      gtaccgcggccgctgattggctccgcggggctgtgggccgccgccggccg
A0A1L1RNM6_MCL1-02      gtaccgcggccgctgattggctccgcggggctgtgggccgccgccggccg
A0A1D5PQZ2_MCL1-01      --------------------------------------------------

A0A1L1RNM6_MCL1-01      cgccgaagccccccgcgctcccattggctccggggcggccccccacgctc
A0A1L1RNM6_MCL1-02      cgccgaagccccccgcgctcccattggctccggggcggccccccacgctc
A0A1D5PQZ2_MCL1-01      --------------------------------------------------

A0A1L1RNM6_MCL1-01      cgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcgg
A0A1L1RNM6_MCL1-02      cgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcgg
A0A1D5PQZ2_MCL1-01      --------------------------------------------------

A0A1L1RNM6_MCL1-01      cccgtcgctctgtggagccccgaggaggagttggacggctgcgagcccga
A0A1L1RNM6_MCL1-02      cccgtcgctctgtggagccccgaggaggagttggacggctgcgagcccga
A0A1D5PQZ2_MCL1-01      --------------------------------------------------

A0A1L1RNM6_MCL1-01      gtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
A0A1L1RNM6_MCL1-02      gtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
A0A1D5PQZ2_MCL1-01      --------------------------------------------------

A0A1L1RNM6_MCL1-01      tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatc
A0A1L1RNM6_MCL1-02      tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatc
A0A1D5PQZ2_MCL1-01      --------------------------------------------------

A0A1L1RNM6_MCL1-01      ctccggtacctccgggaggcggcgggagaggccgagcccggcgttaaaaa
A0A1L1RNM6_MCL1-02      ctccggtacctccgggaggcggcgggagaggccgagcccggcgttaaaaa
A0A1D5PQZ2_MCL1-01      -------------------------gaaaagtctag--------------
                                                 ** * * * **              

A0A1L1RNM6_MCL1-01      gctgtttccggggctcctgggagggccagggcggcccggcagggcgagca
A0A1L1RNM6_MCL1-02      gctgtttccggggctcctgggagggccagggcggcccggcagggcgagca
A0A1D5PQZ2_MCL1-01      --------------------------------------------------

A0A1L1RNM6_MCL1-01      gcgccgtcatggagaaagcgctggaaacgttgcggagggtcggggacggc
A0A1L1RNM6_MCL1-02      gcgccgtcatggagaaagcgctggaaacgttgcggagggtcggggacggc
A0A1D5PQZ2_MCL1-01      --------------------------------------------------

A0A1L1RNM6_MCL1-01      gtgatgcagaaacacgaattggccttccagggaatgcttcggaagctgga
A0A1L1RNM6_MCL1-02      gtgatgcagaaacacgaattggccttccagggaatgcttcggaagctgga
A0A1D5PQZ2_MCL1-01      -----------------------------gggaatgcttcggaagctgga

A0A1L1RNM6_MCL1-01      aatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacg
A0A1L1RNM6_MCL1-02      aatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacg
A0A1D5PQZ2_MCL1-01      aatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacg

A0A1L1RNM6_MCL1-01      ttttcaatgatggagtaacaaactggggccgagttgtcacgctcatctca
A0A1L1RNM6_MCL1-02      ttttcaatgatggagtaacaaactggggccgagttgtcacgctcatctca
A0A1D5PQZ2_MCL1-01      ttttcaatgatggagtaacaaactggggccgagttgtcacgctcatctca

A0A1L1RNM6_MCL1-01      tttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
A0A1L1RNM6_MCL1-02      tttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
A0A1D5PQZ2_MCL1-01      tttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg

A0A1L1RNM6_MCL1-01      catcacctcgctggcggggatcatcacggacgcattggtctcatccaaac
A0A1L1RNM6_MCL1-02      catcacctcgctggcggggatcatcacggacgcattggtctcatccaaac
A0A1D5PQZ2_MCL1-01      catcacctcgctggcggggatcatcacggacgcattggtctcatccaaac

A0A1L1RNM6_MCL1-01      gcgagtggctgatgagccagggaggctgggagggctttgttgacttcttc
A0A1L1RNM6_MCL1-02      gcgagtggctgatgagccagggaggctgggagggctttgttgacttcttc
A0A1D5PQZ2_MCL1-01      gcgagtggctgatgagccagggaggctgggtgag------tcact-----
                        ****************************** * *      * ***     

A0A1L1RNM6_MCL1-01      cgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgc
A0A1L1RNM6_MCL1-02      cgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgc
A0A1D5PQZ2_MCL1-01      ----------gcccaccacgaggctttcagaacgattcagtgtttcctat
                                   **    * *  ** *   *** *      **     *  

A0A1L1RNM6_MCL1-01      aggagtggccggcctgggggcgagcttggcctacatgatccgaaagtgga
A0A1L1RNM6_MCL1-02      aggagtggccggcctgggggcgagcttggcctacatgatccgg-------
A0A1D5PQZ2_MCL1-01      ttccgtaaccca-ctgggtgtcagct--gcctgtgtcagcgaagtgcaga
                            **  **   ***** *  ****  ****   * * *          

A0A1L1RNM6_MCL1-01      gg------------agttga
A0A1L1RNM6_MCL1-02      -----------------tga
A0A1D5PQZ2_MCL1-01      tgagtcactgttccagttaa
                                         * *

© 1998-2019