Dataset for CDS BCL-2-like of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9W6F2_BCL2A1-01        atggaaactgctgagtt---------------------------------
Q07816_BCL2L1-02        atgtc---------------------------------------------
Q07816_BCL2L1-01        atgtc---------------------------------------------
Q07816_BCL2L1-03        atgtc---------------------------------------------
Q00709_BCL2-01          atggct--------------------------------------------
Q00709_BCL2-02          atggct--------------------------------------------
A0A1L1RNM6_MCL1-01      atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcgg
A0A1L1RNM6_MCL1-02      atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcgg
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        -----------------------ctattacgtttattatttag-------
Q07816_BCL2L1-02        -----------------------cagcagtaaccgggagttag-------
Q07816_BCL2L1-01        -----------------------cagcagtaaccgggagttag-------
Q07816_BCL2L1-03        -----------------------cagcagtaaccgggagttag-------
Q00709_BCL2-01          ------caccccgggagaagaggctacgacaaccgcgagatag-------
Q00709_BCL2-02          ------caccccgggagaagaggctacgacaaccgcgagatag-------
A0A1L1RNM6_MCL1-01      cggaggaagcccgggcctggtgcccgcttcaccagcaggagagcaaaccc
A0A1L1RNM6_MCL1-02      cggaggaagcccgggcctggtgcccgcttcaccagcaggagagcaaaccc
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        ---------------------------------------------ctcaa
Q07816_BCL2L1-02        -------------------------------------------tgattga
Q07816_BCL2L1-01        -------------------------------------------tgattga
Q07816_BCL2L1-03        -------------------------------------------tgattga
Q00709_BCL2-01          -------------------------------------------tgctgaa
Q00709_BCL2-02          -------------------------------------------tgctgaa
A0A1L1RNM6_MCL1-01      cgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgag
A0A1L1RNM6_MCL1-02      cgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgag
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        gattatctgcagtatgtgcttc---aggaatcacatctcggaccagccca
Q07816_BCL2L1-02        ctttgtttcctacaagctctcacagagggggcactgctggagcgagctgg
Q07816_BCL2L1-01        ctttgtttcctacaagctctcacagagggggcactgctggagcgagctgg
Q07816_BCL2L1-03        ctttgtttcctacaagctctcacagagggggcactgctggagcgagctgg
Q00709_BCL2-01          gtacatccactataaactctcgcagcggggctacgactgggccgccggcg
Q00709_BCL2-02          gtacatccactataaactctcgcagcggggctacgactgggccgccggcg
A0A1L1RNM6_MCL1-01      gtaccgcggccgctgattggctccgcggggctgtgggccgccgccggccg
A0A1L1RNM6_MCL1-02      gtaccgcggccgctgattggctccgcggggctgtgggccgccgccggccg
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        aaccaga----------------------------------gttgctcat
Q07816_BCL2L1-02        aggaagaggatga------------gaacaggactgacactgcagctgag
Q07816_BCL2L1-01        aggaagaggatga------------gaacaggactgacactgcagctgag
Q07816_BCL2L1-03        aggaagaggatga------------gaacaggactgacactgcagctgag
Q00709_BCL2-01          aggacaggccgcccgtgccccc---ggccccggctcccgctgctgctccc
Q00709_BCL2-02          aggacaggccgcccgtgccccc---ggccccggctcccgctgctgctccc
A0A1L1RNM6_MCL1-01      cgccgaagccccccgcgctcccattggctccgg----ggcggccccccac
A0A1L1RNM6_MCL1-02      cgccgaagccccccgcgctcccattggctccgg----ggcggccccccac
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        gtcttgcgaaacattgca--------------------------------
Q07816_BCL2L1-02        gcagagatggacagcgtcctcaatgggagcccatc---------------
Q07816_BCL2L1-01        gcagagatggacagcgtcctcaatgggagcccatc---------------
Q07816_BCL2L1-03        gcagagatggacagcgtcctcaatgggagcccatc---------------
Q00709_BCL2-01          gctgcggtggctgctgct-------ggagcc-------------------
Q00709_BCL2-02          gctgcggtggctgctgct-------ggagcc-------------------
A0A1L1RNM6_MCL1-01      gctccgatcggttccgcc-------gcggcccgccgggcgccgccggact
A0A1L1RNM6_MCL1-02      gctccgatcggttccgcc-------gcggcccgccgggcgccgccggact
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
Q00709_BCL2-02          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ccacgtcgcggcccgtcgctctgtggagccccgaggaggagttggacggc
A0A1L1RNM6_MCL1-02      ccacgtcgcggcccgtcgctctgtggagccccgaggaggagttggacggc
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q00709_BCL2-01          ----------------------------------------tcctcccacc
Q00709_BCL2-02          ----------------------------------------tcctcccacc
A0A1L1RNM6_MCL1-01      tgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcac
A0A1L1RNM6_MCL1-02      tgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcac
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        -----tcttcactccaagatcagaca------------------------
Q07816_BCL2L1-02        -----ctggcacccccctgccggccacgtagtgaac--------------
Q07816_BCL2L1-01        -----ctggcacccccctgccggccacgtagtgaac--------------
Q07816_BCL2L1-03        -----ctggcacccccctgccggccacgtagtgaac--------------
Q00709_BCL2-01          accgccccgagccccccggctcg-----------gctgctgctag-----
Q00709_BCL2-02          accg-cccgagccccccggctcg-----------gctgctgctag-----
A0A1L1RNM6_MCL1-01      gccg-cccgagctgcccgacttgatccccgacgagctgcggcaggaatcc
A0A1L1RNM6_MCL1-02      gccg-cccgagctgcccgacttgatccccgacgagctgcggcaggaatcc
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        -------------------------------------gaggaggctctca
Q07816_BCL2L1-02        ----------------ggagccaccgtgcaccg----gagcagcctggaa
Q07816_BCL2L1-01        ----------------ggagccaccgtgcaccg----gagcagcctggaa
Q07816_BCL2L1-03        ----------------ggagccaccgtgcaccg----gagcagcctggaa
Q00709_BCL2-01          -------------tgaggtgcccccggct--------gaggggctgcgcc
Q00709_BCL2-02          -------------tgaggtgcccccggct--------gaggggctgcg--
A0A1L1RNM6_MCL1-01      ctggagctcatcctccggtacctccgggaggcggcgggagaggccgagcc
A0A1L1RNM6_MCL1-02      ctggagctcatcctccggtacctccgggaggcggcgggagaggccgagcc
A0A1D5PQZ2_MCL1-01      -------------------------------------gaaaagtctag--
                                                             **   *       

Q9W6F2_BCL2A1-01        gaccctt-------------------------------------------
Q07816_BCL2L1-02        gttcatgaaattgtt----------------------------cgagcat
Q07816_BCL2L1-01        gttcatgaaattgtt----------------------------cgagcat
Q07816_BCL2L1-03        gttcatgaaattgtt----------------------------cgagcat
Q00709_BCL2-01          ccgc-----------------------------------------gcctc
Q00709_BCL2-02          ccgc-----------------------------------------gcctc
A0A1L1RNM6_MCL1-01      cggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccg
A0A1L1RNM6_MCL1-02      cggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccg
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        -----------------------------------------cttggacag
Q07816_BCL2L1-02        ccgacgtgaggcaggcg------------------------ctgagagat
Q07816_BCL2L1-01        ccgacgtgaggcaggcg------------------------ctgagagat
Q07816_BCL2L1-03        ccgacgtgaggcaggcg------------------------ctgagagat
Q00709_BCL2-01          ccggcgtccacctcgcc------------------------ctgcgccag
Q00709_BCL2-02          ccggcgtccacctcgcc------------------------ctgcgccag
A0A1L1RNM6_MCL1-01      gcagggcgagcagcgccgtcatggagaaagcgctggaaacgttgcggagg
A0A1L1RNM6_MCL1-02      gcagggcgagcagcgccgtcatggagaaagcgctggaaacgttgcggagg
A0A1D5PQZ2_MCL1-01      --------------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        gatcgatattacctccgtagatgttgccaagagaattttcaatggagtc-
Q07816_BCL2L1-02        gcgggggatgagtttgagctgaggtacc-ggagggctttcagcgacctca
Q07816_BCL2L1-01        gcgggggatgagtttgagctgaggtacc-ggagggctttcagcgacctca
Q07816_BCL2L1-03        gcgggggatgagtttgagctgaggtacc-ggagggctttcagcgacctca
Q00709_BCL2-01          gccggggacgagttctcgcgccgctacc-agagggacttcgcccagatgt
Q00709_BCL2-02          gccggggacgagttctcgcgccgctacc-agagggacttcgcccagatgt
A0A1L1RNM6_MCL1-01      gtcggggacggcgtgatgcagaaacacg-aattggccttccagggaatgc
A0A1L1RNM6_MCL1-02      gtcggggacggcgtgatgcagaaacacg-aattggccttccagggaatgc
A0A1D5PQZ2_MCL1-01      ------------------------------------------gggaatgc
                                                                       *  

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-02        cctcccagctccacat----------cacccctggcacggcgtaccagag
Q07816_BCL2L1-01        cctcccagctccacat----------cacccctggcacggcgtaccagag
Q07816_BCL2L1-03        cctcccagctccacat----------cacccctggcacggcgtaccagag
Q00709_BCL2-01          cgggccagctgcacct----------gacgcccttcacggcccacggccg
Q00709_BCL2-02          cgggccagctgcacct----------gacgcccttcacggcccacggccg
A0A1L1RNM6_MCL1-01      ttcggaagctggaaatcaaaaaggaagatgacctgca-------------
A0A1L1RNM6_MCL1-02      ttcggaagctggaaatcaaaaaggaagatgacctgca-------------
A0A1D5PQZ2_MCL1-01      ttcggaagctggaaatcaaaaaggaagatgacctgca-------------
                                                                          

Q9W6F2_BCL2A1-01        --------------atggaagaaa--------aatttgctgatggaaata
Q07816_BCL2L1-02        ctttgagcaggta-gtgaatgaac--------tcttccatgatggtgt--
Q07816_BCL2L1-01        ctttgagcaggta-gtgaatgaac--------tcttccatgatggtgt--
Q07816_BCL2L1-03        ctttgagcaggta-gtgaatgaac--------tcttccatgatggtgt--
Q00709_BCL2-01          cttcgtggccgtg-gtggaggagc--------tcttccgtgatggggt--
Q00709_BCL2-02          cttcgtggccgtg-gtggaggagc--------tcttccgtgatggggt--
A0A1L1RNM6_MCL1-01      ------ggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaa
A0A1L1RNM6_MCL1-02      ------ggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaa
A0A1D5PQZ2_MCL1-01      ------ggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaa
                                       **                 **   ******     

Q9W6F2_BCL2A1-01        ctaactggggacgaattatgaccatatttacttttggaggtcttctcacc
Q07816_BCL2L1-02        -gaactgggggcgcatcgtggctttcttctccttcggaggg------g-c
Q07816_BCL2L1-01        -gaactgggggcgcatcgtggctttcttctccttcggaggg------g-c
Q07816_BCL2L1-03        -gaactgggggcgcatcgtggctttcttctccttcggaggg------g-c
Q00709_BCL2-01          -caactggggccggatcgtcgccttcttcgagttcggcggc------g-t
Q00709_BCL2-02          -caactggggccggatcgtcgccttcttcgagttcggcggc------g-t
A0A1L1RNM6_MCL1-01      caaactggggccgagttgtcacgctcatctcatttggtgcctttgttg-c
A0A1L1RNM6_MCL1-02      caaactggggccgagttgtcacgctcatctcatttggtgcctttgttg-c
A0A1D5PQZ2_MCL1-01      caaactggggccgagttgtcacgctcatctcatttggtgcctttgttg-c
                          ******** **  *  *  *  *  *    ** ** *           

Q9W6F2_BCL2A1-01        aagaagcttcaagagcacgga------------gttcagctcactggaga
Q07816_BCL2L1-02        tttgtgcgtggagagcgtggacaaggagatgcgggt------actgg---
Q07816_BCL2L1-01        tttgtgcgtggagagcgtggacaaggagatgcgggt------actgg---
Q07816_BCL2L1-03        tttgtgcgtggagagcgtggacaaggagatgcgggt------actgg---
Q00709_BCL2-01          gatgtgcgtcgagagcgtcaaccgggagatgt------cgccgctgg---
Q00709_BCL2-02          gatgtgcgtcgagagcgtcaaccgggagatgt------cgccgctgg---
A0A1L1RNM6_MCL1-01      aaaacacctgaaaagcatcaaccaagagaaatgcatcacctcgctgg---
A0A1L1RNM6_MCL1-02      aaaacacctgaaaagcatcaaccaagagaaatgcatcacctcgctgg---
A0A1D5PQZ2_MCL1-01      aaaacacctgaaaagcatcaaccaagagaaatgcatcacctcgctgg---
                              * *  * ***    *                      ****   

Q9W6F2_BCL2A1-01        ggagaaggagaagatttcttatttcatcacagagtacatcataaataaca
Q07816_BCL2L1-02        -----tgggacgcattgtgtcttggatgaccacgtacttgaccgaccatc
Q07816_BCL2L1-01        -----tgggacgcattgtgtcttggatgaccacgtacttgaccgaccatc
Q07816_BCL2L1-03        -----tgggacgcattgtgtcttggatgaccacgtacttgaccgaccatc
Q00709_BCL2-01          -----tggacaacattgccacctggatgaccgagtacctgaaccggcacc
Q00709_BCL2-02          -----tggacaacattgccacctggatgaccgagtacctgaaccggcacc
A0A1L1RNM6_MCL1-01      -----cggggatcatcac-----ggacgcattggt--ctcatccaa----
A0A1L1RNM6_MCL1-02      -----cggggatcatcac-----ggacgcattggt--ctcatccaa----
A0A1D5PQZ2_MCL1-01      -----cggggatcatcac-----ggacgcattggt--ctcatccaa----
                              **     **          *       **   * *         

Q9W6F2_BCL2A1-01        aagccgcatggatagatgcaaacggtggctgggaaaacggt---------
Q07816_BCL2L1-02        tagatccctggatccaggagaatggcggctgggagcgctttgtggatctg
Q07816_BCL2L1-01        tagatccctggatccaggagaatggcggctgggagcgctttgtggatctg
Q07816_BCL2L1-03        tagatccctggatccaggagaatggcggctggg-----------------
Q00709_BCL2-01          tgcacaactggatccaggacaacggaggatgggatgcctttgtgga----
Q00709_BCL2-02          tgcacaactggatccaggacaacggaggatgggatgcctttgtgga----
A0A1L1RNM6_MCL1-01      -acgcgagtggctgatgagccagggaggctgggagggctttgttga----
A0A1L1RNM6_MCL1-02      -acgcgagtggctgatgagccagggaggctgggagggctttgttga----
A0A1D5PQZ2_MCL1-01      -acgcgagtggctgatgagccagggaggctgggtgag------tca----
                                *** *        * ** ** ****                 

Q9W6F2_BCL2A1-01        -------------ttcctaacgaagtttgaaagaa---------------
Q07816_BCL2L1-02        tatgggaacaacgctgctgccgagctgaggaagggccaggagaccttca-
Q07816_BCL2L1-01        tatgggaacaacgctgctgccgagctgaggaagggccaggagaccttca-
Q07816_BCL2L1-03        --taagaactgctctcccatag----------------------------
Q00709_BCL2-01          -------------attgtac--------ggcaacagtatgaggcctttg-
Q00709_BCL2-02          -------------attgtac--------ggcaacagtatgaggcctttg-
A0A1L1RNM6_MCL1-01      -------------cttcttccgagttgaggacctggaaagcagcatcagg
A0A1L1RNM6_MCL1-02      -------------cttcttccgagttgaggacctggaaagcagcatcagg
A0A1D5PQZ2_MCL1-01      -------------ct---------------gcccaccacgaggctttcag
                                      *                                   

Q9W6F2_BCL2A1-01        --------gatcacccctatctttctctacaattacagacatatttgcag
Q07816_BCL2L1-02        -----acaaatggctcct----caccggggcgaccgtggccggagtgctt
Q07816_BCL2L1-01        -----acaaatggctcct----caccggggcgaccgtggccggagtgctt
Q07816_BCL2L1-03        --------------------------------------------------
Q00709_BCL2-01          -----ttcgatttctcctggatctctctgaagaccatcctgagcctggtt
Q00709_BCL2-02          -----ttcgatttctcctggatctctctgaagaccatcctgagcctggtt
A0A1L1RNM6_MCL1-01      aatgtgctgatggcctttgcaggagt-----ggccggcctg---------
A0A1L1RNM6_MCL1-02      aatgtgctgatggcctttgcaggagt-----ggccggcctg---------
A0A1D5PQZ2_MCL1-01      aacgattcagtgtttcctatttccgt-----aaccca-ctg---------
                                                                          

Q9W6F2_BCL2A1-01        ctgtt----------------------ctttccttgttcagagagtac--
Q07816_BCL2L1-02        ctgctggga------------------tccctgctgagccgcaagtga--
Q07816_BCL2L1-01        ctgctggga------------------tccctgctgagccgcaagtga--
Q07816_BCL2L1-03        --------------------------------------------------
Q00709_BCL2-01          ctggtgggagcttgcatcactcttggcgcttatcttggacataagtag--
Q00709_BCL2-02          ctggtgggagcttgcatcactcttggcgcttatcttggacataagtag--
A0A1L1RNM6_MCL1-01      --ggggcgagcttg-------------gcctacatgatccgaaagtggag
A0A1L1RNM6_MCL1-02      --ggggcgagcttg-------------gcctacatgatccgg--------
A0A1D5PQZ2_MCL1-01      --ggtgtcagct---------------gcctgtgtcagcgaagtgcagat
                                                                          

Q9W6F2_BCL2A1-01        -------------cactga
Q07816_BCL2L1-02        -------------------
Q07816_BCL2L1-01        -------------------
Q07816_BCL2L1-03        -------------------
Q00709_BCL2-01          -------------------
Q00709_BCL2-02          -------------------
A0A1L1RNM6_MCL1-01      g------------agttga
A0A1L1RNM6_MCL1-02      ----------------tga
A0A1D5PQZ2_MCL1-01      gagtcactgttccagttaa
                                           

© 1998-2018