Dataset for CDS BCL2L1 of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q07816_BCL2L1-03      atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagct
Q07816_BCL2L1-01      atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagct
Q07816_BCL2L1-02      atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagct

Q07816_BCL2L1-03      ctcacagagggggcactgctggagcgagctggaggaagaggatgagaaca
Q07816_BCL2L1-01      ctcacagagggggcactgctggagcgagctggaggaagaggatgagaaca
Q07816_BCL2L1-02      ctcacagagggggcactgctggagcgagctggaggaagaggatgagaaca

Q07816_BCL2L1-03      ggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagc
Q07816_BCL2L1-01      ggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagc
Q07816_BCL2L1-02      ggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagc

Q07816_BCL2L1-03      ccatcctggcacccccctgccggccacgtagtgaacggagccaccgtgca
Q07816_BCL2L1-01      ccatcctggcacccccctgccggccacgtagtgaacggagccaccgtgca
Q07816_BCL2L1-02      ccatcctggcacccccctgccggccacgtagtgaacggagccaccgtgca

Q07816_BCL2L1-03      ccggagcagcctggaagttcatgaaattgttcgagcatccgacgtgaggc
Q07816_BCL2L1-01      ccggagcagcctggaagttcatgaaattgttcgagcatccgacgtgaggc
Q07816_BCL2L1-02      ccggagcagcctggaagttcatgaaattgttcgagcatccgacgtgaggc

Q07816_BCL2L1-03      aggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggct
Q07816_BCL2L1-01      aggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggct
Q07816_BCL2L1-02      aggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggct

Q07816_BCL2L1-03      ttcagcgacctcacctcccagctccacatcacccctggcacggcgtacca
Q07816_BCL2L1-01      ttcagcgacctcacctcccagctccacatcacccctggcacggcgtacca
Q07816_BCL2L1-02      ttcagcgacctcacctcccagctccacatcacccctggcacggcgtacca

Q07816_BCL2L1-03      gagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
Q07816_BCL2L1-01      gagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
Q07816_BCL2L1-02      gagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg

Q07816_BCL2L1-03      ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagc
Q07816_BCL2L1-01      ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagc
Q07816_BCL2L1-02      ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagc

Q07816_BCL2L1-03      gtggacaaggagatgcgggtactggtgggacgcattgtgtcttggatgac
Q07816_BCL2L1-01      gtggacaaggagatgcgggtactggtgggacgcattgtgtcttggatgac
Q07816_BCL2L1-02      gtggacaaggagatgcgggtactggtgggacgcattgtgtcttggatgac

Q07816_BCL2L1-03      cacgtacttgaccgaccatctagatccctggatccaggagaatggcggct
Q07816_BCL2L1-01      cacgtacttgaccgaccatctagatccctggatccaggagaatggcggct
Q07816_BCL2L1-02      cacgtacttgaccgaccatctagatccctggatccaggagaatggcggct

Q07816_BCL2L1-03      ggg-------------------taagaactgctctcccatag--------
Q07816_BCL2L1-01      gggagcgctttgtggatctgtatgggaacaacgctgctgccgagctgagg
Q07816_BCL2L1-02      gggagcgctttgtggatctgtatgggaacaacgctgctgccgagctgagg
                      ***                   *  ****  * ** *    *        

Q07816_BCL2L1-03      --------------------------------------------------
Q07816_BCL2L1-01      aagggccaggagaccttcaacaaatggctcctcaccggggcgaccgtggc
Q07816_BCL2L1-02      aagggccaggagaccttcaacaaatggctcctcaccggggcgaccgtggc

Q07816_BCL2L1-03      ----------------------------------------
Q07816_BCL2L1-01      cggagtgcttctgctgggatccctgctgagccgcaagtga
Q07816_BCL2L1-02      cggagtgcttctgctgggatccctgctgagccgcaagtga

© 1998-2019