Dataset for CDS BCL-2 of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q00709_BCL2-01      atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccac
Q00709_BCL2-02      atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccac
                    ************************************************************

Q00709_BCL2-01      tataaactctcgcagcggggctacgactgggccgccggcgaggacaggccgcccgtgccc
Q00709_BCL2-02      tataaactctcgcagcggggctacgactgggccgccggcgaggacaggccgcccgtgccc
                    ************************************************************

Q00709_BCL2-01      ccggccccggctcccgctgctgctcccgctgcggtggctgctgctggagcctcctcccac
Q00709_BCL2-02      ccggccccggctcccgctgctgctcccgctgcggtggctgctgctggagcctcctcccac
                    ************************************************************

Q00709_BCL2-01      caccgccccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctg
Q00709_BCL2-02      caccg-cccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctg
                    ***** ******************************************************

Q00709_BCL2-01      cgccccgcgcctcccggcgtccacctcgccctgcgccaggccggggacgagttctcgcgc
Q00709_BCL2-02      cg--ccgcgcctcccggcgtccacctcgccctgcgccaggccggggacgagttctcgcgc
                    **  ********************************************************

Q00709_BCL2-01      cgctaccagagggacttcgcccagatgtcgggccagctgcacctgacgcccttcacggcc
Q00709_BCL2-02      cgctaccagagggacttcgcccagatgtcgggccagctgcacctgacgcccttcacggcc
                    ************************************************************

Q00709_BCL2-01      cacggccgcttcgtggccgtggtggaggagctcttccgtgatggggtcaactggggccgg
Q00709_BCL2-02      cacggccgcttcgtggccgtggtggaggagctcttccgtgatggggtcaactggggccgg
                    ************************************************************

Q00709_BCL2-01      atcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatg
Q00709_BCL2-02      atcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatg
                    ************************************************************

Q00709_BCL2-01      tcgccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcac
Q00709_BCL2-02      tcgccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcac
                    ************************************************************

Q00709_BCL2-01      aactggatccaggacaacggaggatgggatgcctttgtggaattgtacggcaacagtatg
Q00709_BCL2-02      aactggatccaggacaacggaggatgggatgcctttgtggaattgtacggcaacagtatg
                    ************************************************************

Q00709_BCL2-01      aggcctttgttcgatttctcctggatctctctgaagaccatcctgagcctggttctggtg
Q00709_BCL2-02      aggcctttgttcgatttctcctggatctctctgaagaccatcctgagcctggttctggtg
                    ************************************************************

Q00709_BCL2-01      ggagcttgcatcactcttggcgcttatcttggacataagtag
Q00709_BCL2-02      ggagcttgcatcactcttggcgcttatcttggacataagtag
                    ******************************************

© 1998-2018