Dataset for CDS MCL-1 of organism Gadus morhua

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


D2ITA0_MCL1-03      atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggttt
D2ITA0_MCL1-04      atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggttt
                    ************************************************************

D2ITA0_MCL1-03      aacagccctcaaaatggaggcgaagagcgaaacatggacttccactccgaaggttcacac
D2ITA0_MCL1-04      aacagccctcaaaatggaggcgaagagcgaaacatggacttccactccgaaggttcacac
                    ************************************************************

D2ITA0_MCL1-03      accacgacagagggggccttgcctctaatggcgacgttcaaaagcggagacgaacgtaaa
D2ITA0_MCL1-04      accacgacagagggggccttgcctctaatggcgacgttcaaaagcggagacgaacgtaaa
                    ************************************************************

D2ITA0_MCL1-03      ccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
D2ITA0_MCL1-04      ccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
                    ************************************************************

D2ITA0_MCL1-03      ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccag
D2ITA0_MCL1-04      ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccag
                    ************************************************************

D2ITA0_MCL1-03      gcgggggaagaagtgttggataacgacaccaagcgaatcattcgcatttttctcagagac
D2ITA0_MCL1-04      gcgggggaagaagtgttggataacgacaccaagcgaatcattcgcatttttctcagagac
                    ************************************************************

D2ITA0_MCL1-03      tatgcaggggcatcaaaagctaaaaggacaagacaagacgaggttcaagtgactatgaga
D2ITA0_MCL1-04      tatgcaggggcatcaaaagctaaaaggacaagacaagacgaggttcaagtgactatgaga
                    ************************************************************

D2ITA0_MCL1-03      agagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
D2ITA0_MCL1-04      agagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
                    ************************************************************

D2ITA0_MCL1-03      ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctc
D2ITA0_MCL1-04      ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctc
                    ************************************************************

D2ITA0_MCL1-03      ttcgcagacagcacaacaaactgggggcgtatcgccagcctggtggccttcggagcagcg
D2ITA0_MCL1-04      ttcgcagacagcacaacaaactgggggcgtatcgccagcctggtggccttcggagcagcg
                    ************************************************************

D2ITA0_MCL1-03      ttgtgtcagtacctagaggccaggggtaaagaaggctgcgtgtcgctggtggccgaggag
D2ITA0_MCL1-04      ttgtgtcagtacctagaggccaggggtaaagaaggctgcgtgtcgctggtggccgaggag
                    ************************************************************

D2ITA0_MCL1-03      atttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
D2ITA0_MCL1-04      atttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
                    ************************************************************

D2ITA0_MCL1-03      ggcttcgtagagttttttcgagtgtcagaccctgagacgacagtgagaaatacactcatg
D2ITA0_MCL1-04      ggcttcgtagagttttttcgagtgtcagaccctgagacgacagtgagaaatacactcatg
                    ************************************************************

D2ITA0_MCL1-03      gcctttgctggatttgctggtattggtgcaacaattgccctactaatcaggtga
D2ITA0_MCL1-04      gcctttgctggatttgctggtattggtgcaacaattgccctactaatcaggtga
                    ******************************************************

© 1998-2018