Dataset for CDS BCL-2-like of organism Gadus morhua

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


D2ITA0_MCL1-03         atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagac
D2ITA0_MCL1-04         atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagac
D2IT42_BCL2L10-02      atgtcg--------------tgtaggctgtggaaagagacc---------
D2ITA2_BCL2L1-02       atg---------------------agcattgacacaagcat---------
                       ***                       *   *  *  **            

D2ITA0_MCL1-03         ctgctggtttaacagccctcaaaatggaggcgaagagcgaaacatggact
D2ITA0_MCL1-04         ctgctggtttaacagccctcaaaatggaggcgaagagcgaaacatggact
D2IT42_BCL2L10-02      ---ctggccctgt--c-----------------agaggactacctgttgt
D2ITA2_BCL2L1-02       ---gtcgatcagtaac-----------------agagaa----ctggtgt
                           * *        *                 ****       **   *

D2ITA0_MCL1-03         tccactccgaaggttcacacaccacgacagagg------gggccttgcct
D2ITA0_MCL1-04         tccactccgaaggttcacacaccacgacagagg------gggccttgcct
D2IT42_BCL2L10-02      cctgcactgcaag--------------cacagg---cacagccccgccgc
D2ITA2_BCL2L1-02       tcttcttcctaag-ccataaactgtctcagaggaattacaggcctattcc
                        *  *     * *              ** ***       * **      

D2ITA0_MCL1-03         ctaatggcgacgttcaaaagcggagacgaacgtaaaccaagacccacgga
D2ITA0_MCL1-04         ctaatggcgacgttcaaaagcggagacgaacgtaaaccaagacccacgga
D2IT42_BCL2L10-02      ct----------------------------cccag--cgagtcagccgcg
D2ITA2_BCL2L1-02       ct----------------------------tccagcccgagggggcag--
                       **                               *   * **      *  

D2ITA0_MCL1-03         actaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaagga-
D2ITA0_MCL1-04         actaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaagga-
D2IT42_BCL2L10-02      gccatgaggggactggcccagga--------ca-----------------
D2ITA2_BCL2L1-02       ---gtgaggggactga-tgagga--------caagtccaacaggattggt
                            ** *** * *      **        **                 

D2ITA0_MCL1-03         ---aacggttcgctgcctagcactccggaactccagtcagaagtagacac
D2ITA0_MCL1-04         ---aacggttcgctgcctagcactccggaactccagtcagaagtagacac
D2IT42_BCL2L10-02      ---------------tggagcg-gcagca---------------------
D2ITA2_BCL2L1-02       aataatgggttacggttgaacg-acggtaacggcaatggccagttggcgc
                                         * *   * * *                     

D2ITA0_MCL1-03         ggacagccaggcg---ggggaagaagtgttggataacgacaccaagcgaa
D2ITA0_MCL1-04         ggacagccaggcg---ggggaagaagtgttggataacgacaccaagcgaa
D2IT42_BCL2L10-02      ------ctacgct--------------------------cgc--------
D2ITA2_BCL2L1-02       catcacctactccacaaggcacggaggctgtgagggcagcgc--------
                             * *  *                           * *        

D2ITA0_MCL1-03         tcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaagg
D2ITA0_MCL1-04         tcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaagg
D2IT42_BCL2L10-02      -------------ttccaggctctggcccagagctt--------------
D2ITA2_BCL2L1-02       -------------ttctagaatcggtggaagagtttgagttgcgctacac
                                    *   **   *       * *  *              

D2ITA0_MCL1-03         acaagacaagacgaggttcaagtgactatgagaagagttgtagacggcgt
D2ITA0_MCL1-04         acaagacaagacgaggttcaagtgactatgagaagagttgtagacggcgt
D2IT42_BCL2L10-02      cctggcc------------------cagtgcga-----------------
D2ITA2_BCL2L1-02       gctggcc------------------ttcagcgacctgtcgtcccagctgc
                        *  * *                      * **                 

D2ITA0_MCL1-03         gcttgaaaaacaccaatacgcatacaagggtatgatccagaaattggaat
D2ITA0_MCL1-04         gcttgaaaaacaccaatacgcatacaagggtatgatccagaaattggaat
D2IT42_BCL2L10-02      ----------ggccg--acgcatgc---gccggcctccgcaaggt-----
D2ITA2_BCL2L1-02       ccatcacccccgcca--cggcctac---ggtagcttcgaaagcgt-----
                                   **     ** * *   *      **   *   *     

D2ITA0_MCL1-03         tggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagt
D2ITA0_MCL1-04         tggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagt
D2IT42_BCL2L10-02      --gatggaggagctg-----------------------------------
D2ITA2_BCL2L1-02       --gatggacgaggtg-----------------------------------
                         ** **  ***  *                                   

D2ITA0_MCL1-03         ctcttcgcagacagcacaacaaactgggggcgtatcgccagcctggtggc
D2ITA0_MCL1-04         ctcttcgcagacagcacaacaaactgggggcgtatcgccagcctggtggc
D2IT42_BCL2L10-02      ---gtgggagacggacagttgaactgggggagggtagtttccctcttcac
D2ITA2_BCL2L1-02       ---ttcagggacag-ca--tcaactggggacgcatagtgggcctgtttgc
                           *    *** *       ********  *  * *    ***  *  *

D2ITA0_MCL1-03         cttcggagcagcgttgtgtcagtaccta-----------gaggccagggg
D2ITA0_MCL1-04         cttcggagcagcgttgtgtcagtaccta-----------gaggccagggg
D2IT42_BCL2L10-02      ctttaccggggtgctggccagacaactgcaggagaagaagggggtacaac
D2ITA2_BCL2L1-02       cttcgggggggccct----------ctgcgtg-------gagtgtg----
                       ***    *  *   *          **            * *        

D2ITA0_MCL1-03         taaagaaggc----------------------------tgcgtgtcgctg
D2ITA0_MCL1-04         taaagaaggc----------------------------tgcgtgtcgctg
D2IT42_BCL2L10-02      tggggcaggaccccgggacgggcagggcactgggaca-ggttcccggcgg
D2ITA2_BCL2L1-02       tggagaagga------gatgagcc----------acatggtgccccgcg-
                       *   * ***                              *      **  

D2ITA0_MCL1-03         g-------------tggccgaggagatttcctcatacctcctttcagacc
D2ITA0_MCL1-04         g-------------tggccgaggagatttcctcatacctcctttcagacc
D2IT42_BCL2L10-02      gagctgcagggggctggcggagacgatagcggactacctaggggaggaga
D2ITA2_BCL2L1-02       --------------tggcagagtggatgaccaggtacctggacgaccaca
                                     **** ***  ***  *    *****        *  

D2ITA0_MCL1-03         aacgggaatggttggtcaaaaacaactcatgggagggcttcgtag-agtt
D2ITA0_MCL1-04         aacgggaatggttggtcaaaaacaactcatgggagggcttcgtag-agtt
D2IT42_BCL2L10-02      agagggactggctgctggagaacgggggctgggaa-----------gggt
D2ITA2_BCL2L1-02       ttgaccactggatccagagcaacggaggatggaaacactttgctgcggtt
                             * *** *       ***      *** *             * *

D2ITA0_MCL1-03         ttttcgagtgtcagaccctgagacgacagtgagaaatacactcatggcct
D2ITA0_MCL1-04         ttttcgagtgtcagaccctgagacgacagtgagaaatacactcatggcct
D2IT42_BCL2L10-02      tttgtaagt----tctccaggatcgcccgagag--gtgaaccaagagtct
D2ITA2_BCL2L1-02       tttggaagc----gacgcggcagcgggagcgag--gcgtacccgggacag
                       ***   **         * *   **   * ***      **         

D2ITA0_MCL1-03         ttgctggatttgctggtattggtgc-------------------------
D2ITA0_MCL1-04         ttgctggatttgctggtattggtgc-------------------------
D2IT42_BCL2L10-02      tcgatgaagacggcgctgttcgcggccgccggggtgggcatcgcag----
D2ITA2_BCL2L1-02       tcacaggagatg--gatgctggtgggcgcggcgctgctgactggggtgct
                       *    * *   *  * *  * * *                          

D2ITA0_MCL1-03         aacaattgccctactaatcagg---------tga
D2ITA0_MCL1-04         aacaattgccctactaatcagg---------tga
D2IT42_BCL2L10-02      gcctgacgttccttttggtgcg--------ctag
D2ITA2_BCL2L1-02       gctcggggctctgctcgccaagaaacatgtctag
                              *  *   *      *         *  

© 1998-2018