Dataset for CDS MCL-1 of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M3XAP4_MCL1-02      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccggg
Q7YRZ9_MCL1-01      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccggg
M3XAP4_MCL1-03      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccggg
M3XAP4_MCL1-01      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccggg
                    ************************************************************

M3XAP4_MCL1-02      ttggcggccgggagcggcggcgcctcctcttcgggagggcggcttgtggctgtggggaag
Q7YRZ9_MCL1-01      ttggcggccgggagcggcggcgcctcctcttcgggagggcggcttgtggctgtggggaag
M3XAP4_MCL1-03      ttggcggccgggagcggcggcgcctcctcttcgggagggcggcttgt-------------
M3XAP4_MCL1-01      ttggcggccgggagcggcggcgcctcctcttcgggagggcggcttgtggctgtggggaag
                    ***********************************************             

M3XAP4_MCL1-02      gaggccacggccaggcgagaggtagggggaggggaagccggtgcggtgattggcggaagc
Q7YRZ9_MCL1-01      gaggccacggccaggcgagaggtagggggaggggaagccggtgcggtgattggcggaagc
M3XAP4_MCL1-03      ------------------------------------------------------------
M3XAP4_MCL1-01      gaggccacggccaggcgagaggtagggggaggggaagccggtgcggtgattggcggaagc
                                                                                

M3XAP4_MCL1-02      gccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
Q7YRZ9_MCL1-01      gccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
M3XAP4_MCL1-03      ------------------------------------------------------------
M3XAP4_MCL1-01      gccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
                                                                                

M3XAP4_MCL1-02      cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcg
Q7YRZ9_MCL1-01      cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcg
M3XAP4_MCL1-03      ------------------------------------------------------------
M3XAP4_MCL1-01      cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcg
                                                                                

M3XAP4_MCL1-02      gccacccgctgtgcgtcgccgcctgaaaagatggaaggcccagccgccgacgccatcatg
Q7YRZ9_MCL1-01      gccacccgctgtgcgtcgccgcctgaagagatggaaggcccagccgccgacgccatcatg
M3XAP4_MCL1-03      ------------------------------------------------------------
M3XAP4_MCL1-01      gccacccgctgtgcgtcgccgcctgaaaagatggaaggcccagccgccgacgccatcatg
                                                                                

M3XAP4_MCL1-02      tcgcccgaagaggagctagacgggtacgagccagaacctctggggaagcggccggctgtc
Q7YRZ9_MCL1-01      tcgcccgaagaggagctagacgggtacgagccagaacctctggggaagcggccggctgtc
M3XAP4_MCL1-03      ------------------------------------------------------------
M3XAP4_MCL1-01      tcgcccgaagaggagctagacgggtacgagccagaacctctggggaagcggccggctgtc
                                                                                

M3XAP4_MCL1-02      ctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
Q7YRZ9_MCL1-01      ctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
M3XAP4_MCL1-03      ------------------------------------------------------------
M3XAP4_MCL1-01      ctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
                                                                                

M3XAP4_MCL1-02      ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggag
Q7YRZ9_MCL1-01      ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggag
M3XAP4_MCL1-03      ------------------------------------------------------------
M3XAP4_MCL1-01      ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggag
                                                                                

M3XAP4_MCL1-02      attatctctcggtaccttcgggagcaggcgaccggcgccaaggacgcgaaaccactgggc
Q7YRZ9_MCL1-01      attatctctcggtaccttcgggagcaggcgaccggcgccaaggacgcgaaaccactgggc
M3XAP4_MCL1-03      --------------------------ggcgaccggcgccaaggacgcgaaaccactgggc
M3XAP4_MCL1-01      attatctctcggtaccttcgggagcaggcgaccggcgccaaggacgcgaaaccactgggc
                                              **********************************

M3XAP4_MCL1-02      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcggggacggcgtg
Q7YRZ9_MCL1-01      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcggggacggcgtg
M3XAP4_MCL1-03      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcggggacggcgtg
M3XAP4_MCL1-01      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcggggacggcgtg
                    ************************************************************

M3XAP4_MCL1-02      cagcgcaaccacgagaccgccttccaa---------------------------------
Q7YRZ9_MCL1-01      cagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
M3XAP4_MCL1-03      cagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
M3XAP4_MCL1-01      cagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
                    ***************************                                 

M3XAP4_MCL1-02      ------------------------------------------------------------
Q7YRZ9_MCL1-01      aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaac
M3XAP4_MCL1-03      aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaac
M3XAP4_MCL1-01      aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaac
                                                                                

M3XAP4_MCL1-02      ------------------------------------------------------------
Q7YRZ9_MCL1-01      tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagt
M3XAP4_MCL1-03      tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagt
M3XAP4_MCL1-01      tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagt
                                                                                

M3XAP4_MCL1-02      ------------------------------------------------------------
Q7YRZ9_MCL1-01      ataaaccaagaaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtaagg
M3XAP4_MCL1-03      ataaaccaagaaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtaagg
M3XAP4_MCL1-01      ataaaccaagaaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtaagg
                                                                                

M3XAP4_MCL1-02      -----------------------------------ggatgggtttgtggagttcttccat
Q7YRZ9_MCL1-01      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
M3XAP4_MCL1-03      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
M3XAP4_MCL1-01      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
                                                       *************************

M3XAP4_MCL1-02      gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgga
Q7YRZ9_MCL1-01      gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgga
M3XAP4_MCL1-03      gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgga
M3XAP4_MCL1-01      gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgga
                    ************************************************************

M3XAP4_MCL1-02      gtaggagctggtttggcatatctaataagatagccttttaa
Q7YRZ9_MCL1-01      gtaggagctggtttggcatatctaataagatag--------
M3XAP4_MCL1-03      gtaggagctggtttggcatatctaataagatag--------
M3XAP4_MCL1-01      gtaggagctggtttggcatatctaataagatag--------
                    *********************************        

© 1998-2019