Dataset for CDS BCL-2-like of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M3X1R9_BCL2-01          atggcgcacgctgggagaa---cagggtatgataaccgggagatagtcat
M3XA94_BCL2L1-01        atgtct----------------cagag-----caaccgggagctggtggt
Q8SQ42_BCL2L1-01        atgtct----------------cagag-----caaccgggagctggtggt
A0A337STN9_BCL2A1-      atgg------------------ccga-------cggcgagtttgggt---
A0A337STN9_BCL2A1-      atgg------------------ccga-------cggcgagtttgggt---
A0A337RYG8_BCL2L10      atgg------------------ctgac-----gcgttgagggagcgc---
A0A2I2UAE3_BCL2L2-      atggcgaccccagcctcagccccagac-----aca-------cgggc---
M3XAP4_MCL1-02          atg-----tttggcctcaa---gagaa-----acgctgtaatcggac---
Q7YRZ9_MCL1-01          atg-----tttggcctcaa---gagaa-----acgctgtaatcggac---
M3XAP4_MCL1-01          atg-----tttggcctcaa---gagaa-----acgctgtaatcggac---
M3XAP4_MCL1-03          atg-----tttggcctcaa---gagaa-----acgctgtaatcggac---
                        ***                     *                         

M3X1R9_BCL2-01          gaagtacatccactataagctgtcgcagagg----------ggctacgag
M3XA94_BCL2L1-01        tgactttctctcctacaagctttcccagaaaggatacagctggagtcagt
Q8SQ42_BCL2L1-01        tgactttctctcctacaagctttcccagaaaggatacagctggagtcggt
A0A337STN9_BCL2A1-      --acgttctc----------------------------------------
A0A337STN9_BCL2A1-      --acgttctc----------------------------------------
A0A337RYG8_BCL2L10      --ac----------ggcgc----------------------agctactga
A0A2I2UAE3_BCL2L2-      --tcta--------gtggc----------------------agact----
M3XAP4_MCL1-02          --tcaacctctactgtggg----------------------ggggccggg
Q7YRZ9_MCL1-01          --tcaacctctactgtggg----------------------ggggccggg
M3XAP4_MCL1-01          --tcaacctctactgtggg----------------------ggggccggg
M3XAP4_MCL1-03          --tcaacctctactgtggg----------------------ggggccggg

M3X1R9_BCL2-01          tgggatgccgggga--cgcgggcgccgcgcccccgggggccgcccccgcg
M3XA94_BCL2L1-01        ttagtgatgtggaagagaacagaactgaggccccagaaggg---actgaa
Q8SQ42_BCL2L1-01        ttagtgatgtggaagagaacagaactgaggccccagaaggg---actgaa
A0A337STN9_BCL2A1-      acgctggcccgggactatacggagcacgttctgcaggg------------
A0A337STN9_BCL2A1-      acgctggcccgggactatacggagcacgttctgcaggg------------
A0A337RYG8_BCL2L10      ctgactacctggagtactgcgcc----------cgggagcccggc-----
A0A2I2UAE3_BCL2L2-      ttgtaggctataag--ctgagg-----------cagaaggg----ttatg
M3XAP4_MCL1-02          ttggcggccgggag--cggcggcgcctcctcttcgggagggcggcttgtg
Q7YRZ9_MCL1-01          ttggcggccgggag--cggcggcgcctcctcttcgggagggcggcttgtg
M3XAP4_MCL1-01          ttggcggccgggag--cggcggcgcctcctcttcgggagggcggcttgtg
M3XAP4_MCL1-03          ttggcggccgggag--cggcggcgcctcctcttcgggagggcggcttgt-
                                                         * *              

M3X1R9_BCL2-01          ccgggcatcttctcctcccagcccgggcgcacccctgcgcccgccaggac
M3XA94_BCL2L1-01        tcagagatggagacccccagtgcca-------------t--caatggcaa
Q8SQ42_BCL2L1-01        tcagagatggagacccccagtgcca-------------t--caatggcaa
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      tttgtggagcag--------------------------------------
M3XAP4_MCL1-02          gctgtggggaaggaggccacggccaggcgagaggtaggg--ggaggggaa
Q7YRZ9_MCL1-01          gctgtggggaaggaggccacggccaggcgagaggtaggg--ggaggggaa
M3XAP4_MCL1-01          gctgtggggaaggaggccacggccaggcgagaggtaggg--ggaggggaa
M3XAP4_MCL1-03          --------------------------------------------------

M3X1R9_BCL2-01          ctccccgccgccgcccccggtcgcccccgccgccgccgccg----ccgcc
M3XA94_BCL2L1-01        cccatcctggcacttggcggacagccctgcggtgaatggagccactggcc
Q8SQ42_BCL2L1-01        cccatcctggcacttggcagacagccctgcggtgaatggagccactggcc
A0A337STN9_BCL2A1-      ----------------------gccccagcc--------------cgggt
A0A337STN9_BCL2A1-      ----------------------gccccagcc--------------cgggt
A0A337RYG8_BCL2L10      ----------------------agccccgcg--------------cggac
A0A2I2UAE3_BCL2L2-      ----------------------gccctgggg--------------agggc
M3XAP4_MCL1-02          gccggtgcggtgattggcggaagcgccggcg--------------cgagc
Q7YRZ9_MCL1-01          gccggtgcggtgattggcggaagcgccggcg--------------cgagc
M3XAP4_MCL1-01          gccggtgcggtgattggcggaagcgccggcg--------------cgagc
M3XAP4_MCL1-03          --------------------------------------------------

M3X1R9_BCL2-01          gccgccgcgggccctgcgctcagcc--------ccgtgccacctgtggtc
M3XA94_BCL2L1-01        acagcagcagcttggatgcccgggaggtgatccccatggcagcggtgaag
Q8SQ42_BCL2L1-01        acagcagcagcttggatgcccgggaggtgatccccatggcagcggtcaaa
A0A337STN9_BCL2A1-      ccca--------cccaagcagagta--------tcccaagtgctacaaga
A0A337STN9_BCL2A1-      ccca--------cccaagcagagta--------tcccaagtgctacaaga
A0A337RYG8_BCL2L10      gccg--------tccacgcccgagg--------ccgcg-gtgct-----g
A0A2I2UAE3_BCL2L2-      ccagcagctgacccactgcaccaag--------ccatgcgtgca-----g
M3XAP4_MCL1-02          cccccagccactctcgcgcccgacg--------cccggagggtc-----g
Q7YRZ9_MCL1-01          cccccagccactctcgcgcccgacg--------cccggagggtc-----g
M3XAP4_MCL1-01          cccccagccactctcgcgcccgacg--------cccggagggtc-----g
M3XAP4_MCL1-03          --------------------------------------------------

M3X1R9_BCL2-01          cacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccg
M3XA94_BCL2L1-01        caggcg---ctgagggaggccggggatgagtttgaactgaggtaccggcg
Q8SQ42_BCL2L1-01        caagcg---ctgagggaggctggggatgagtttgaactgaggtaccggcg
A0A337STN9_BCL2A1-      cgtg-g---ccttctcggtccagggggaggtcgagaagaagttgaagccg
A0A337STN9_BCL2A1-      cgtg-g---ccttctcggtccagggggaggtcgagaagaagttgaagccg
A0A337RYG8_BCL2L10      cgct-a---cct--------ggccgcccagatacggcagcgccaccagcg
A0A2I2UAE3_BCL2L2-      c-------------------tggagatgagtttgagacccgcttccggcg
M3XAP4_MCL1-02          cgcg-g---ccctcgcccattggtgccgag----ggccccgacgtcaccg
Q7YRZ9_MCL1-01          cgcg-g---ccctcgcccattggtgccgag----ggccccgacgtcaccg
M3XAP4_MCL1-01          cgcg-g---ccctcgcccattggtgccgag----ggccccgacgtcaccg
M3XAP4_MCL1-03          --------------------------------------------------

M3X1R9_BCL2-01          cgacttcgcgga-------------gatgtccagcc----agctgcacct
M3XA94_BCL2L1-01        ggcattcagcga----------cctgacatccc-------agcttcacat
Q8SQ42_BCL2L1-01        ggcattcagtga----------cctgacatccc-------agcttcacat
A0A337STN9_BCL2A1-      tgcctggacaag----------------------------ttccatgtgg
A0A337STN9_BCL2A1-      tgcctggacaag----------------------------ttccatgtgg
A0A337RYG8_BCL2L10      tttcttgtcggc---------ttaccgcggctaccgcggaaaccgcgtgg
A0A2I2UAE3_BCL2L2-      caccttctctga----------tttggcagc--cc-----agttgcatgt
M3XAP4_MCL1-02          cgacccccccgaagctgctgttcttcgcggccacc-----cgctgtgcgt
Q7YRZ9_MCL1-01          cgacccccccgaagctgctgttcttcgcggccacc-----cgctgtgcgt
M3XAP4_MCL1-01          cgacccccccgaagctgctgttcttcgcggccacc-----cgctgtgcgt
M3XAP4_MCL1-03          --------------------------------------------------

M3X1R9_BCL2-01          gacaccc-------------tttaccgca-----aggggacgctttgcca
M3XA94_BCL2L1-01        cacccca-------------gggacagca-----tatcagagctttgagc
Q8SQ42_BCL2L1-01        cacccca-------------gggacagca-----tatcagagctttgagc
A0A337STN9_BCL2A1-      tgtcggt------------agacacggcca----ggacgatattccacca
A0A337STN9_BCL2A1-      tgtcggt------------agacacggcca----ggacgatattccacca
A0A337RYG8_BCL2L10      aactggt-------------ggcgcggttggag-caggatttactctcca
A0A2I2UAE3_BCL2L2-      gacccct-------------gggtcagcc-----cagcaacgcttcaccc
M3XAP4_MCL1-02          cgccgcctgaaaagatggaaggcccagccgccgacgccatcatgtcgccc
Q7YRZ9_MCL1-01          cgccgcctgaagagatggaaggcccagccgccgacgccatcatgtcgccc
M3XAP4_MCL1-01          cgccgcctgaaaagatggaaggcccagccgccgacgccatcatgtcgccc
M3XAP4_MCL1-03          --------------------------------------------------

M3X1R9_BCL2-01          cg------------------------------------------------
M3XA94_BCL2L1-01        ag------------------------------------------------
Q8SQ42_BCL2L1-01        ag------------------------------------------------
A0A337STN9_BCL2A1-      agtgatggaaaag-------------------------------------
A0A337STN9_BCL2A1-      agtgatggaaaag-------------------------------------
A0A337RYG8_BCL2L10      a-------------------------------------------------
A0A2I2UAE3_BCL2L2-      ag------------------------------------------------
M3XAP4_MCL1-02          gaagaggagctagacgggtacgagccagaacctctggggaagcggccggc
Q7YRZ9_MCL1-01          gaagaggagctagacgggtacgagccagaacctctggggaagcggccggc
M3XAP4_MCL1-01          gaagaggagctagacgggtacgagccagaacctctggggaagcggccggc
M3XAP4_MCL1-03          --------------------------------------------------

M3X1R9_BCL2-01          ------gtggtggaggagctcttcagggatggagtgaactgggggaggat
M3XA94_BCL2L1-01        ------gtagtgaacgaactcttccgggatggggtgaactggggtcgcat
Q8SQ42_BCL2L1-01        ------gtagtgaatgaactcttccgggatggggtgaactggggtcgcat
A0A337STN9_BCL2A1-      ---------------gaatttgaagacggcatcattaactggggcaggat
A0A337STN9_BCL2A1-      ---------------gaatttgaagacggcatcattaactggggcaggat
A0A337RYG8_BCL2L10      -----------------------cccccaaaccctcagttggggccatgt
A0A2I2UAE3_BCL2L2-      ------gtctctgatgaactcttccaagggggccccaactggggccgcct
M3XAP4_MCL1-02          tgtcctgcctttgctggagttggtcggggaggccagcagtggccccggca
Q7YRZ9_MCL1-01          tgtcctgcctttgctggagttggtcggggaggccagcagtggccccggca
M3XAP4_MCL1-01          tgtcctgcctttgctggagttggtcggggaggccagcagtggccccggca
M3XAP4_MCL1-03          --------------------------------------------------

M3X1R9_BCL2-01          tgtggccttctttgagttcggtggggtcat--------------------
M3XA94_BCL2L1-01        tgtggcctttttctccttcggtggggcact--------------------
Q8SQ42_BCL2L1-01        tgtggcctttttctccttcggtggggcact--------------------
A0A337STN9_BCL2A1-      tgtgactatatttgcgtttgagggcatcct--------------------
A0A337STN9_BCL2A1-      tgtgactatatttgcgtttgagggcatcct--------------------
A0A337RYG8_BCL2L10      ggtagcgctcttgaccttcgcggggacgct--------------------
A0A2I2UAE3_BCL2L2-      tgtggccttctttgtctttggagccgcact--------------------
M3XAP4_MCL1-02          cagacggctcactgccctcgacgccacccccagcagaggaggaggaggac
Q7YRZ9_MCL1-01          cagacggctcactgccctcgacgccacccccagcagaggaggaggaggac
M3XAP4_MCL1-01          cagacggctcactgccctcgacgccacccccagcagaggaggaggaggac
M3XAP4_MCL1-03          --------------------------------------------------

M3X1R9_BCL2-01          --------------------------------------------gtgtgt
M3XA94_BCL2L1-01        --------------------------------------------gtgcgt
Q8SQ42_BCL2L1-01        --------------------------------------------gtgcgt
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337RYG8_BCL2L10      -------gctgg--------------------------------------
A0A2I2UAE3_BCL2L2-      ---gtgtgctgagagt----------------------------------
M3XAP4_MCL1-02          gagttgttccggcagtcgctggagattatctctcggtaccttcgggagca
Q7YRZ9_MCL1-01          gagttgttccggcagtcgctggagattatctctcggtaccttcgggagca
M3XAP4_MCL1-01          gagttgttccggcagtcgctggagattatctctcggtaccttcgggagca
M3XAP4_MCL1-03          --------------------------------------------------

M3X1R9_BCL2-01          ggagagcgtcaaccgagagatgtcgcccctgg------------------
M3XA94_BCL2L1-01        ggaaagcgtagacaaggagatgcaggtattgg------------------
Q8SQ42_BCL2L1-01        ggagagcgtagacaaggagatgcaggtattgg------------------
A0A337STN9_BCL2A1-      ---------catcaagaag------cttctc-------------------
A0A337STN9_BCL2A1-      ---------catcaagaag------cttctc-------------------
A0A337RYG8_BCL2L10      agagaccgccgccggggac------ctacttg---aacctgacgccggac
A0A2I2UAE3_BCL2L2-      -------gtcaacaaggagatggagccacttg-------tgg-gac----
M3XAP4_MCL1-02          ggcgaccggcgccaaggacgcgaaaccactgggcgggtctgg-ggcggcc
Q7YRZ9_MCL1-01          ggcgaccggcgccaaggacgcgaaaccactgggcgggtctgg-ggcggcc
M3XAP4_MCL1-01          ggcgaccggcgccaaggacgcgaaaccactgggcgggtctgg-ggcggcc
M3XAP4_MCL1-03          ggcgaccggcgccaaggacgcgaaaccactgggcgggtctgg-ggcggcc
                                    *    *           *                    

M3X1R9_BCL2-01          ----------tggacaacatcgccctgtggatgactgagtacctgaaccg
M3XA94_BCL2L1-01        --------------tgag--------tcggatcgcaacttggatggccac
Q8SQ42_BCL2L1-01        --------------tgag--------tcggatcgcagcttggatggccac
A0A337STN9_BCL2A1-      ------------caggag---------cggatcgt--------cccagac
A0A337STN9_BCL2A1-      ------------caggag---------cggatcgt--------cccagac
A0A337RYG8_BCL2L10      cagcaacaggagctggag-------------tgggagaccaacgttggcc
A0A2I2UAE3_BCL2L2-      -------aagtgcaagag---------tggatggtggcctacctggagac
M3XAP4_MCL1-02          agccgaaaggcgttagagaccctccgacgggtcggggacggcgtgcag-c
Q7YRZ9_MCL1-01          agccgaaaggcgttagagaccctccgacgggtcggggacggcgtgcag-c
M3XAP4_MCL1-01          agccgaaaggcgttagagaccctccgacgggtcggggacggcgtgcag-c
M3XAP4_MCL1-03          agccgaaaggcgttagagaccctccgacgggtcggggacggcgtgcag-c
                                        *              *                  

M3X1R9_BCL2-01          gcacctgcaca------------------------cctggatccaagaca
M3XA94_BCL2L1-01        ttacctg---------aacgaccacctaga---gccttggatccaggaga
Q8SQ42_BCL2L1-01        ttacctg---------aatgaccacctaga---gccttggatccaggaga
A0A337STN9_BCL2A1-      gcggatgcgtt-----taaggtttcctactttgtcgccgagttcatcacg
A0A337STN9_BCL2A1-      gcggatgcgtt-----taaggtttcctactttgtcgccgagttcatcacg
A0A337RYG8_BCL2L10      aggactgccagcacctggtggcttt--------gctctgcaatcggctca
A0A2I2UAE3_BCL2L2-      acggctggccg-----actggattcaca-----gcagtgggggctgggcg
M3XAP4_MCL1-02          gcaaccacgag-----accgccttccaa----------------------
Q7YRZ9_MCL1-01          gcaaccacgag-----accgccttccaaggcatgcttcggaaactggaca
M3XAP4_MCL1-01          gcaaccacgag-----accgccttccaaggcatgcttcggaaactggaca
M3XAP4_MCL1-03          gcaaccacgag-----accgccttccaaggcatgcttcggaaactggaca

M3X1R9_BCL2-01          --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337RYG8_BCL2L10      cc------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------gagttcacagctctat--------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          tcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatggtccatgtt
M3XAP4_MCL1-01          tcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatggtccatgtt
M3XAP4_MCL1-03          tcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatggtccatgtt

M3X1R9_BCL2-01          --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      -------------aaacacacgggagaatggatccg--------------
A0A337STN9_BCL2A1-      -------------aaacacacgggagaatggatccg--------------
A0A337RYG8_BCL2L10      -----------------------ggacggcatcgcg--------------
A0A2I2UAE3_BCL2L2-      -------------------acggggacggggccctg--------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          ttcagtgacggagtaacaaactggggcaggattgtgactcttatttcttt
M3XAP4_MCL1-01          ttcagtgacggagtaacaaactggggcaggattgtgactcttatttcttt
M3XAP4_MCL1-03          ttcagtgacggagtaacaaactggggcaggattgtgactcttatttcttt

M3X1R9_BCL2-01          --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          tggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
M3XAP4_MCL1-01          tggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
M3XAP4_MCL1-03          tggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca

M3X1R9_BCL2-01          --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          tcgaaccattagcagaaagcatcacagatgttcttgtaaggacaaaacga
M3XAP4_MCL1-01          tcgaaccattagcagaaagcatcacagatgttcttgtaaggacaaaacga
M3XAP4_MCL1-03          tcgaaccattagcagaaagcatcacagatgttcttgtaaggacaaaacga

M3X1R9_BCL2-01          ----------------acggaggctgggatgc-ctttgtggaactgt---
M3XA94_BCL2L1-01        ----------------acggcggctgggacac-ttttgtggaactct---
Q8SQ42_BCL2L1-01        ----------------acggcggctgggatac-ttttgtggaactct---
A0A337STN9_BCL2A1-      -----------gcaaaacggaggctggca------ctcagt---------
A0A337STN9_BCL2A1-      -----------gcaaaacggaggctgggaaaacggctttgt---------
A0A337RYG8_BCL2L10      -cctggctggaggctcacgacggctgggatggcttttgtctcttcttctc
A0A2I2UAE3_BCL2L2-      -------------------gaggaggcgcggc-gtctgcggg--------
M3XAP4_MCL1-02          --------------------------ggatgg-gtttgtggagttcttcc
Q7YRZ9_MCL1-01          gactggctagtcaaacaaagaggctgggatgg-gtttgtggagttcttcc
M3XAP4_MCL1-01          gactggctagtcaaacaaagaggctgggatgg-gtttgtggagttcttcc
M3XAP4_MCL1-03          gactggctagtcaaacaaagaggctgggatgg-gtttgtggagttcttcc

M3X1R9_BCL2-01          ------------------acggcccc-------agcatgcagcctctgtt
M3XA94_BCL2L1-01        ----acgggaacaatgcagcggccgagagccggaagggccaggagcgctt
Q8SQ42_BCL2L1-01        ----acgggaacaatgcagcagccgagagccggaagggccaggagcgctc
A0A337STN9_BCL2A1-      ------------------------------a--------------caagt
A0A337STN9_BCL2A1-      ------------------------------aaggaagttcgaacccaagt
A0A337RYG8_BCL2L10      acccatgctgcc--------atcttcttggagaagactgctggtccaggc
A0A2I2UAE3_BCL2L2-      ----aggggaactg------ggcctcagtgaggacagtgctgacaggggc
M3XAP4_MCL1-02          atgtagaggacctagaaggtggcatc----agaaatgtgctgct---ggc
Q7YRZ9_MCL1-01          atgtagaggacctagaaggtggcatc----agaaatgtgctgct---ggc
M3XAP4_MCL1-01          atgtagaggacctagaaggtggcatc----agaaatgtgctgct---ggc
M3XAP4_MCL1-03          atgtagaggacctagaaggtggcatc----agaaatgtgctgct---ggc

M3X1R9_BCL2-01          tgatttctcctggctgtccctgaaggccctgctcagtctggccctggtgg
M3XA94_BCL2L1-01        caaccgctggttcctgacaggcatgactgtggctggcgtggttctgctgg
Q8SQ42_BCL2L1-01        caaccgctggttcctgacaggcatgactgtggctggcgtggttctgctgg
A0A337STN9_BCL2A1-      ttag----------------------------------------------
A0A337STN9_BCL2A1-      ctggctggctgacctttct--ggaagtt----acaggaaagatctgtaag
A0A337RYG8_BCL2L10      tcttctgtcatgctttacagtaatgatc----ttaatctacttctggaga
A0A2I2UAE3_BCL2L2-      c------------gtggcactgggggcc----ctggta----actgtagg
M3XAP4_MCL1-02          t------------tttgca--ggtgttg----ctgg--------agtagg
Q7YRZ9_MCL1-01          t------------tttgca--ggtgttg----ctgg--------agtagg
M3XAP4_MCL1-01          t------------tttgca--ggtgttg----ctgg--------agtagg
M3XAP4_MCL1-03          t------------tttgca--ggtgttg----ctgg--------agtagg

M3X1R9_BCL2-01          gggcttgcatcaccctgggtgcctatctgggccacaagtga---------
M3XA94_BCL2L1-01        gctcact------------------cttcagtcggaaatga---------
Q8SQ42_BCL2L1-01        gctcact------------------cttcagtcggaaatga---------
A0A337STN9_BCL2A1-      --------------------------------------------------
A0A337STN9_BCL2A1-      gtattgt------------------ctctcctgaagaactactactga--
A0A337RYG8_BCL2L10      agattat------------------tgtga--------------------
A0A2I2UAE3_BCL2L2-      ggccttt------------------tttg-----ctagcaagtga-----
M3XAP4_MCL1-02          agctggt------------------ttggcatatctaataagatagcctt
Q7YRZ9_MCL1-01          agctggt------------------ttggcatatctaataagatag----
M3XAP4_MCL1-01          agctggt------------------ttggcatatctaataagatag----
M3XAP4_MCL1-03          agctggt------------------ttggcatatctaataagatag----

M3X1R9_BCL2-01          ----
M3XA94_BCL2L1-01        ----
Q8SQ42_BCL2L1-01        ----
A0A337STN9_BCL2A1-      ----
A0A337STN9_BCL2A1-      ----
A0A337RYG8_BCL2L10      ----
A0A2I2UAE3_BCL2L2-      ----
M3XAP4_MCL1-02          ttaa
Q7YRZ9_MCL1-01          ----
M3XAP4_MCL1-01          ----
M3XAP4_MCL1-03          ----

© 1998-2019