Dataset for CDS BCL-2-like of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M3X1R9_BCL2-01          atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaa
M3XA94_BCL2L1-01        atg------tctcagag------------caaccgggagctggtggttga
Q8SQ42_BCL2L1-01        atg------tctcagag------------caaccgggagctggtggttga
M3WHW2_BCL2A1-01        atg------gccgacgg------------cgagtttgggtacgtt-----
M3WHW2_BCL2A1-02        atg------gccgacgg------------cgagtttgggtacgtt-----
A0A2I2UAE3_BCL2L2-      atggcg-accccagcct------------cagccccagacaca-------
M3XAP4_MCL1-02          atg------tttggcct------------caa---gagaaacgctgtaat
Q7YRZ9_MCL1-01          atg------tttggcct------------caa---gagaaacgctgtaat
M3XAP4_MCL1-03          atg------tttggcct------------caa---gagaaacgctgtaat
M3XAP4_MCL1-01          atg------tttggcct------------caa---gagaaacgctgtaat
                        ***                                               

M3X1R9_BCL2-01          gtacatccactataagctgtcgcagaggggctacgagtgggat-------
M3XA94_BCL2L1-01        ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
Q8SQ42_BCL2L1-01        ctttctctcctacaagctttcccagaaaggatacagctggagtcggttta
M3WHW2_BCL2A1-01        ----ctcac---------------------------gctggcccgg----
M3WHW2_BCL2A1-02        ----ctcac---------------------------gctggcccgg----
A0A2I2UAE3_BCL2L2-      cgggctcta--------gt----------------ggcagact----ttg
M3XAP4_MCL1-02          cggactcaacctctactgt----------------gggggggccgggttg
Q7YRZ9_MCL1-01          cggactcaacctctactgt----------------gggggggccgggttg
M3XAP4_MCL1-03          cggactcaacctctactgt----------------gggggggccgggttg
M3XAP4_MCL1-01          cggactcaacctctactgt----------------gggggggccgggttg
                             **                                *          

M3X1R9_BCL2-01          --gccggggacgcg---ggcgccgcgcccccgggggccgcccccgcgccg
M3XA94_BCL2L1-01        gtgatgtggaagagaacagaactgaggccccagaaggg---actgaatca
Q8SQ42_BCL2L1-01        gtgatgtggaagagaacagaactgaggccccagaaggg---actgaatca
M3WHW2_BCL2A1-01        --gactatacggag--cac--------gttctgcaggg------------
M3WHW2_BCL2A1-02        --gactatacggag--cac--------gttctgcaggg------------
A0A2I2UAE3_BCL2L2-      taggctataagctg--agg-----------cagaaggg----ttatgttt
M3XAP4_MCL1-02          gcggccgggagcgg--cggcgcctcctcttcgggagggcggcttgtggct
Q7YRZ9_MCL1-01          gcggccgggagcgg--cggcgcctcctcttcgggagggcggcttgtggct
M3XAP4_MCL1-03          gcggccgggagcgg--cggcgcctcctcttcgggagggcggcttgt----
M3XAP4_MCL1-01          gcggccgggagcgg--cggcgcctcctcttcgggagggcggcttgtggct
                          *          *                * *  *              

M3X1R9_BCL2-01          ggcatcttctcctcccagcccgggcgcacccctgcgcccgccaggacctc
M3XA94_BCL2L1-01        gagatggagacccccagtgcca-------------t--caatggcaaccc
Q8SQ42_BCL2L1-01        gagatggagacccccagtgcca-------------t--caatggcaaccc
M3WHW2_BCL2A1-01        --------------------------------------------------
M3WHW2_BCL2A1-02        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      gtggagcag-----------------------------------------
M3XAP4_MCL1-02          gtggggaaggaggccacggccaggcgagaggtaggg--ggaggggaagcc
Q7YRZ9_MCL1-01          gtggggaaggaggccacggccaggcgagaggtaggg--ggaggggaagcc
M3XAP4_MCL1-03          --------------------------------------------------
M3XAP4_MCL1-01          gtggggaaggaggccacggccaggcgagaggtaggg--ggaggggaagcc
                                                                          

M3X1R9_BCL2-01          cccgccgccgcccccggtcgcccccgccgc----cgccgccgccgccgcc
M3XA94_BCL2L1-01        atcctggcacttggcggacagccctgcggtgaatggagccactggccaca
Q8SQ42_BCL2L1-01        atcctggcacttggcagacagccctgcggtgaatggagccactggccaca
M3WHW2_BCL2A1-01        -------------------gccccagcc------cgggtcccacccaagc
M3WHW2_BCL2A1-02        -------------------gccccagcc------cgggtcccacccaagc
A0A2I2UAE3_BCL2L2-      -------------------gccctgggg------agggcccagc------
M3XAP4_MCL1-02          ggtgcggtgattggcggaagcgccggcg------cgagcccccc------
Q7YRZ9_MCL1-01          ggtgcggtgattggcggaagcgccggcg------cgagcccccc------
M3XAP4_MCL1-03          --------------------------------------------------
M3XAP4_MCL1-01          ggtgcggtgattggcggaagcgccggcg------cgagcccccc------
                                                                          

M3X1R9_BCL2-01          gccgcgggccctgcgctcagcc--------ccgtgccacctgtggtccac
M3XA94_BCL2L1-01        gcagcagcttggatgcccgggaggtgatccccatggca---gcggtgaag
Q8SQ42_BCL2L1-01        gcagcagcttggatgcccgggaggtgatccccatggca---gcggtcaaa
M3WHW2_BCL2A1-01        agagtatcccaagtgctacaag--------acgtggcc---ttctc----
M3WHW2_BCL2A1-02        agagtatcccaagtgctacaag--------acgtggcc---ttctc----
A0A2I2UAE3_BCL2L2-      --agctgacccactgcaccaag--------ccatgcgt---gcagc----
M3XAP4_MCL1-02          --agccactctcgcgcccgacg--------cccggagg---gtcgc----
Q7YRZ9_MCL1-01          --agccactctcgcgcccgacg--------cccggagg---gtcgc----
M3XAP4_MCL1-03          --------------------------------------------------
M3XAP4_MCL1-01          --agccactctcgcgcccgacg--------cccggagg---gtcgc----
                                                                          

M3X1R9_BCL2-01          ctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcga
M3XA94_BCL2L1-01        caggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggc
Q8SQ42_BCL2L1-01        caagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggc
M3WHW2_BCL2A1-01        --ggtccagggggaggtcgagaagaagttgaagccgtg------------
M3WHW2_BCL2A1-02        --ggtccagggggaggtcgagaagaagttgaagccgtg------------
A0A2I2UAE3_BCL2L2-      -----------------tggagatgagtttgagacccgcttccggcgcac
M3XAP4_MCL1-02          --gcggccctcgcccattggtgccga----gggccccgacgtcaccgcga
Q7YRZ9_MCL1-01          --gcggccctcgcccattggtgccga----gggccccgacgtcaccgcga
M3XAP4_MCL1-03          --------------------------------------------------
M3XAP4_MCL1-01          --gcggccctcgcccattggtgccga----gggccccgacgtcaccgcga
                                                                          

M3X1R9_BCL2-01          cttcgcggagatgtccag------------ccagctgcacctgacaccct
M3XA94_BCL2L1-01        attcagcga----------cctgacatc--ccagcttcacatcacccc--
Q8SQ42_BCL2L1-01        attcagtga----------cctgacatc--ccagcttcacatcacccc--
M3WHW2_BCL2A1-01        ---cctgga---------------------caagttccatgtggtgtc--
M3WHW2_BCL2A1-02        ---cctgga---------------------caagttccatgtggtgtc--
A0A2I2UAE3_BCL2L2-      cttctctga----------tttggcagc--ccagttgcatgtgacccct-
M3XAP4_MCL1-02          cccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcct
Q7YRZ9_MCL1-01          cccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcct
M3XAP4_MCL1-03          --------------------------------------------------
M3XAP4_MCL1-01          cccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcct
                                                                          

M3X1R9_BCL2-01          tt-------------accgc-----aaggggacgctttgccacg------
M3XA94_BCL2L1-01        -----------agggacagc-----atatcagagctttgagcag------
Q8SQ42_BCL2L1-01        -----------agggacagc-----atatcagagctttgagcag------
M3WHW2_BCL2A1-01        --------ggtagacacggcc----aggacgatattccaccaagtgatgg
M3WHW2_BCL2A1-02        --------ggtagacacggcc----aggacgatattccaccaagtgatgg
A0A2I2UAE3_BCL2L2-      ------------gggtcagcc-----cagcaacgcttcacccag------
M3XAP4_MCL1-02          gaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagagga
Q7YRZ9_MCL1-01          gaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagagga
M3XAP4_MCL1-03          --------------------------------------------------
M3XAP4_MCL1-01          gaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagagga
                                                                          

M3X1R9_BCL2-01          ------------------------------------------------gt
M3XA94_BCL2L1-01        ------------------------------------------------gt
Q8SQ42_BCL2L1-01        ------------------------------------------------gt
M3WHW2_BCL2A1-01        aaaag---------------------------------------------
M3WHW2_BCL2A1-02        aaaag---------------------------------------------
A0A2I2UAE3_BCL2L2-      ------------------------------------------------gt
M3XAP4_MCL1-02          gctagacgggtacgagccagaacctctggggaagcggccggctgtcctgc
Q7YRZ9_MCL1-01          gctagacgggtacgagccagaacctctggggaagcggccggctgtcctgc
M3XAP4_MCL1-03          --------------------------------------------------
M3XAP4_MCL1-01          gctagacgggtacgagccagaacctctggggaagcggccggctgtcctgc
                                                                          

M3X1R9_BCL2-01          ggtggaggagctcttcagggatggagtgaactgggggaggattgtggcct
M3XA94_BCL2L1-01        agtgaacgaactcttccgggatggggtgaactggggtcgcattgtggcct
Q8SQ42_BCL2L1-01        agtgaatgaactcttccgggatggggtgaactggggtcgcattgtggcct
M3WHW2_BCL2A1-01        -------gaatttgaagacggcatcattaactggggcaggattgtgacta
M3WHW2_BCL2A1-02        -------gaatttgaagacggcatcattaactggggcaggattgtgacta
A0A2I2UAE3_BCL2L2-      ctctgatgaactcttccaagggggccccaactggggccgccttgtggcct
M3XAP4_MCL1-02          ctttgctggagttggtcggggaggccagcagtggccccggcacagacggc
Q7YRZ9_MCL1-01          ctttgctggagttggtcggggaggccagcagtggccccggcacagacggc
M3XAP4_MCL1-03          --------------------------------------------------
M3XAP4_MCL1-01          ctttgctggagttggtcggggaggccagcagtggccccggcacagacggc
                                                                          

M3X1R9_BCL2-01          tctttgagttcggtggggtcat-----------------------gtgtg
M3XA94_BCL2L1-01        ttttctccttcggtggggcact-----------------------gtgcg
Q8SQ42_BCL2L1-01        ttttctccttcggtggggcact-----------------------gtgcg
M3WHW2_BCL2A1-01        tatttgcgtttgagggcatcct----------------------------
M3WHW2_BCL2A1-02        tatttgcgtttgagggcatcct----------------------------
A0A2I2UAE3_BCL2L2-      tctttgtctttggagccgcact-----------------------gtgtg
M3XAP4_MCL1-02          tcactgccctcgacgccacccccagcagaggaggaggaggacgagttgtt
Q7YRZ9_MCL1-01          tcactgccctcgacgccacccccagcagaggaggaggaggacgagttgtt
M3XAP4_MCL1-03          --------------------------------------------------
M3XAP4_MCL1-01          tcactgccctcgacgccacccccagcagaggaggaggaggacgagttgtt
                                                                          

M3X1R9_BCL2-01          tggagagc-----------------------------------------g
M3XA94_BCL2L1-01        tggaaagc-----------------------------------------g
Q8SQ42_BCL2L1-01        tggagagc-----------------------------------------g
M3WHW2_BCL2A1-01        --------------------------------------------------
M3WHW2_BCL2A1-02        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      ctgagagt-----------------------------------------g
M3XAP4_MCL1-02          ccggcagtcgctggagattatctctcggtaccttcgggagcaggcgaccg
Q7YRZ9_MCL1-01          ccggcagtcgctggagattatctctcggtaccttcgggagcaggcgaccg
M3XAP4_MCL1-03          ------------------------------------------ggcgaccg
M3XAP4_MCL1-01          ccggcagtcgctggagattatctctcggtaccttcgggagcaggcgaccg
                                                                          

M3X1R9_BCL2-01          tcaaccgagagatgtcgcccctgg--------------------------
M3XA94_BCL2L1-01        tagacaaggagatgcaggtattgg--------------------------
Q8SQ42_BCL2L1-01        tagacaaggagatgcaggtattgg--------------------------
M3WHW2_BCL2A1-01        -catcaa------gaagcttctc---------------------------
M3WHW2_BCL2A1-02        -catcaa------gaagcttctc---------------------------
A0A2I2UAE3_BCL2L2-      tcaacaaggagatggagccacttg-------tgggac-----------aa
M3XAP4_MCL1-02          gcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaag
Q7YRZ9_MCL1-01          gcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaag
M3XAP4_MCL1-03          gcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaag
M3XAP4_MCL1-01          gcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaag
                            *        *       *                            

M3X1R9_BCL2-01          -tggacaacatcgccctgtggatgactgagtacctgaaccggcacctgca
M3XA94_BCL2L1-01        -----tgag--------tcggatcg----caacttggatggccacttacc
Q8SQ42_BCL2L1-01        -----tgag--------tcggatcg----cagcttggatggccacttacc
M3WHW2_BCL2A1-01        ---caggag---------cggatcgt--------cccagacgcggatgcg
M3WHW2_BCL2A1-02        ---caggag---------cggatcgt--------cccagacgcggatgcg
A0A2I2UAE3_BCL2L2-      gtgcaagag---------tggatggtggcctacctggagacacggctggc
M3XAP4_MCL1-02          gcgttagagaccctccgacgggtcggggacggcgtgcag-cgcaaccacg
Q7YRZ9_MCL1-01          gcgttagagaccctccgacgggtcggggacggcgtgcag-cgcaaccacg
M3XAP4_MCL1-03          gcgttagagaccctccgacgggtcggggacggcgtgcag-cgcaaccacg
M3XAP4_MCL1-01          gcgttagagaccctccgacgggtcggggacggcgtgcag-cgcaaccacg
                               *           ** *              *    *       

M3X1R9_BCL2-01          ca-------------------cctggatccaagaca--------------
M3XA94_BCL2L1-01        tgaacgaccaccta---gagccttggatccaggaga--------------
Q8SQ42_BCL2L1-01        tgaatgaccaccta---gagccttggatccaggaga--------------
M3WHW2_BCL2A1-01        tttaaggtttccta------ctttgtcgcc--------------------
M3WHW2_BCL2A1-02        tttaaggtttccta------ctttgtcgcc--------------------
A0A2I2UAE3_BCL2L2-      cgactggattcaca-----gcagtgggggctgggcg--------------
M3XAP4_MCL1-02          agaccgccttccaa------------------------------------
Q7YRZ9_MCL1-01          agaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaaaac
M3XAP4_MCL1-03          agaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaaaac
M3XAP4_MCL1-01          agaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaaaac
                                                                          

M3X1R9_BCL2-01          --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3WHW2_BCL2A1-01        gagttcatcac-------------------------------------ga
M3WHW2_BCL2A1-02        gagttcatcac-------------------------------------ga
A0A2I2UAE3_BCL2L2-      gagttcacagctctat----------------------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          gatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagt
M3XAP4_MCL1-03          gatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagt
M3XAP4_MCL1-01          gatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagt
                                                                          

M3X1R9_BCL2-01          -----acggaggctgggatgcc----------------------------
M3XA94_BCL2L1-01        -----acggcggctgggacact----------------------------
Q8SQ42_BCL2L1-01        -----acggcggctgggatact----------------------------
M3WHW2_BCL2A1-01        aacacacgggagaatggatccg----------------------------
M3WHW2_BCL2A1-02        aacacacgggagaatggatccg----------------------------
A0A2I2UAE3_BCL2L2-      -----acggggacggggccctg----------------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          aacaaactggggcaggattgtgactcttatttcttttggtgcctttgtgg
M3XAP4_MCL1-03          aacaaactggggcaggattgtgactcttatttcttttggtgcctttgtgg
M3XAP4_MCL1-01          aacaaactggggcaggattgtgactcttatttcttttggtgcctttgtgg
                                                                          

M3X1R9_BCL2-01          --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3WHW2_BCL2A1-02        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          ccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagca
M3XAP4_MCL1-03          ccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagca
M3XAP4_MCL1-01          ccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagca
                                                                          

M3X1R9_BCL2-01          --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3WHW2_BCL2A1-02        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3XAP4_MCL1-02          --------------------------------------------------
Q7YRZ9_MCL1-01          gaaagcatcacagatgttcttgtaaggacaaaacgagactggctagtcaa
M3XAP4_MCL1-03          gaaagcatcacagatgttcttgtaaggacaaaacgagactggctagtcaa
M3XAP4_MCL1-01          gaaagcatcacagatgttcttgtaaggacaaaacgagactggctagtcaa
                                                                          

M3X1R9_BCL2-01          -------------------tttgtggaactgtac--------ggccccag
M3XA94_BCL2L1-01        -------------------tttgtggaactct-------acgggaacaat
Q8SQ42_BCL2L1-01        -------------------tttgtggaactct-------acgggaacaat
M3WHW2_BCL2A1-01        ----------------------gcaaa------------acggaggctgg
M3WHW2_BCL2A1-02        ----------------------gcaaa------------acggaggctgg
A0A2I2UAE3_BCL2L2-      -----gaggaggcgcggcgtctgcggg------------aggggaactg-
M3XAP4_MCL1-02          ------------ggatgggtttgtggagttcttccatgtagaggacctag
Q7YRZ9_MCL1-01          acaaagaggctgggatgggtttgtggagttcttccatgtagaggacctag
M3XAP4_MCL1-03          acaaagaggctgggatgggtttgtggagttcttccatgtagaggacctag
M3XAP4_MCL1-01          acaaagaggctgggatgggtttgtggagttcttccatgtagaggacctag
                                              *                   *   *   

M3X1R9_BCL2-01          catgcagcctctgtttgatttctcctggctgtccctgaaggccctgctca
M3XA94_BCL2L1-01        gcagcggcc----------gagagccggaagggccagga-gcgcttcaac
Q8SQ42_BCL2L1-01        gcagcagcc----------gagagccggaagggccagga-gcgctccaac
M3WHW2_BCL2A1-01        gaaaacggctttgtaaggaagttcgaacccaagtctggc-tggctgacct
M3WHW2_BCL2A1-02        ca------ctcagta--------------caagtttag------------
A0A2I2UAE3_BCL2L2-      -----ggcctcagtgaggacagtgctgacaggggccgtg-gcactggggg
M3XAP4_MCL1-02          aaggtggcatc----agaaatgtgctgct---ggctttt-gca--ggtgt
Q7YRZ9_MCL1-01          aaggtggcatc----agaaatgtgctgct---ggctttt-gca--ggtgt
M3XAP4_MCL1-03          aaggtggcatc----agaaatgtgctgct---ggctttt-gca--ggtgt
M3XAP4_MCL1-01          aaggtggcatc----agaaatgtgctgct---ggctttt-gca--ggtgt
                                                                          

M3X1R9_BCL2-01          gtctggccctggtgggg----------gcttgcatcaccctgggtgccta
M3XA94_BCL2L1-01        cgctggttcctgacaggcatgactgtggctggcgtggttctgctgggctc
Q8SQ42_BCL2L1-01        cgctggttcctgacaggcatgactgtggctggcgtggttctgctgggctc
M3WHW2_BCL2A1-01        ttctggaagttacaggaaagatctgtaa--ggtattgtctctcctgaaga
M3WHW2_BCL2A1-02        --------------------------------------------------
A0A2I2UAE3_BCL2L2-      ccctggtaactgtaggg-------------------gccttttttg----
M3XAP4_MCL1-02          tgctgg----agtagga-------------------gctggtttggcata
Q7YRZ9_MCL1-01          tgctgg----agtagga-------------------gctggtttggcata
M3XAP4_MCL1-03          tgctgg----agtagga-------------------gctggtttggcata
M3XAP4_MCL1-01          tgctgg----agtagga-------------------gctggtttggcata
                                                                          

M3X1R9_BCL2-01          tctgggccacaagtga---------
M3XA94_BCL2L1-01        act----cttcagtcggaaatga--
Q8SQ42_BCL2L1-01        act----cttcagtcggaaatga--
M3WHW2_BCL2A1-01        act----actactga----------
M3WHW2_BCL2A1-02        -------------------------
A0A2I2UAE3_BCL2L2-      -ct----agcaagtga---------
M3XAP4_MCL1-02          tct----aataagatagccttttaa
Q7YRZ9_MCL1-01          tct----aataagatag--------
M3XAP4_MCL1-03          tct----aataagatag--------
M3XAP4_MCL1-01          tct----aataagatag--------
                                                 

© 1998-2018