Dataset for CDS BCL2L1 of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M3XA94_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q8SQ42_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct

M3XA94_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q8SQ42_BCL2L1-01      ttcccagaaaggatacagctggagtcggtttagtgatgtggaagagaaca
                      ************************** ***********************

M3XA94_BCL2L1-01      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
Q8SQ42_BCL2L1-01      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc

M3XA94_BCL2L1-01      atcaatggcaacccatcctggcacttggcggacagccctgcggtgaatgg
Q8SQ42_BCL2L1-01      atcaatggcaacccatcctggcacttggcagacagccctgcggtgaatgg
                      ***************************** ********************

M3XA94_BCL2L1-01      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
Q8SQ42_BCL2L1-01      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg

M3XA94_BCL2L1-01      cagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgagg
Q8SQ42_BCL2L1-01      cagcggtcaaacaagcgctgagggaggctggggatgagtttgaactgagg
                      ******* ** ** ************** *********************

M3XA94_BCL2L1-01      taccggcgggcattcagcgacctgacatcccagcttcacatcaccccagg
Q8SQ42_BCL2L1-01      taccggcgggcattcagtgacctgacatcccagcttcacatcaccccagg
                      ***************** ********************************

M3XA94_BCL2L1-01      gacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
Q8SQ42_BCL2L1-01      gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
                      ********************************* ****************

M3XA94_BCL2L1-01      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
Q8SQ42_BCL2L1-01      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg

M3XA94_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q8SQ42_BCL2L1-01      tgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                      ******** *****************************************

M3XA94_BCL2L1-01      aacttggatggccacttacctgaacgaccacctagagccttggatccagg
Q8SQ42_BCL2L1-01      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
                      * ********************** *************************

M3XA94_BCL2L1-01      agaacggcggctgggacacttttgtggaactctacgggaacaatgcagcg
Q8SQ42_BCL2L1-01      agaacggcggctgggatacttttgtggaactctacgggaacaatgcagca
                      **************** ******************************** 

M3XA94_BCL2L1-01      gccgagagccggaagggccaggagcgcttcaaccgctggttcctgacagg
Q8SQ42_BCL2L1-01      gccgagagccggaagggccaggagcgctccaaccgctggttcctgacagg
                      **************************** *********************

M3XA94_BCL2L1-01      catgactgtggctggcgtggttctgctgggctcactcttcagtcggaaat
Q8SQ42_BCL2L1-01      catgactgtggctggcgtggttctgctgggctcactcttcagtcggaaat

M3XA94_BCL2L1-01      ga
Q8SQ42_BCL2L1-01      ga

© 1998-2019