Dataset for CDS BCL2A1 of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A337STN9_BCL2A1-      atggccgacggcgagtttgggtacgttctcacgctggcccgggactatac
A0A337STN9_BCL2A1-      atggccgacggcgagtttgggtacgttctcacgctggcccgggactatac

A0A337STN9_BCL2A1-      ggagcacgttctgcaggggccccagcccgggtcccacccaagcagagtat
A0A337STN9_BCL2A1-      ggagcacgttctgcaggggccccagcccgggtcccacccaagcagagtat

A0A337STN9_BCL2A1-      cccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaag
A0A337STN9_BCL2A1-      cccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaag

A0A337STN9_BCL2A1-      aagttgaagccgtgcctggacaagttccatgtggtgtcggtagacacggc
A0A337STN9_BCL2A1-      aagttgaagccgtgcctggacaagttccatgtggtgtcggtagacacggc

A0A337STN9_BCL2A1-      caggacgatattccaccaagtgatggaaaaggaatttgaagacggcatca
A0A337STN9_BCL2A1-      caggacgatattccaccaagtgatggaaaaggaatttgaagacggcatca

A0A337STN9_BCL2A1-      ttaactggggcaggattgtgactatatttgcgtttgagggcatcctcatc
A0A337STN9_BCL2A1-      ttaactggggcaggattgtgactatatttgcgtttgagggcatcctcatc

A0A337STN9_BCL2A1-      aagaagcttctccaggagcggatcgtcccagacgcggatgcgtttaaggt
A0A337STN9_BCL2A1-      aagaagcttctccaggagcggatcgtcccagacgcggatgcgtttaaggt

A0A337STN9_BCL2A1-      ttcctactttgtcgccgagttcatcacgaaacacacgggagaatggatcc
A0A337STN9_BCL2A1-      ttcctactttgtcgccgagttcatcacgaaacacacgggagaatggatcc

A0A337STN9_BCL2A1-      ggcaaaacggaggctggca------ctcagta--------------caag
A0A337STN9_BCL2A1-      ggcaaaacggaggctgggaaaacggctttgtaaggaagttcgaacccaag
                        ***************** *      **  ***              ****

A0A337STN9_BCL2A1-      tttag---------------------------------------------
A0A337STN9_BCL2A1-      tctggctggctgacctttctggaagttacaggaaagatctgtaaggtatt
                        * * *                                             

A0A337STN9_BCL2A1-      -------------------------
A0A337STN9_BCL2A1-      gtctctcctgaagaactactactga

© 1998-2019