Dataset for CDS BCL2A1 of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M3WHW2_BCL2A1-01      atggccgacggcgagtttgggtacgttctcacgctggcccgggactatac
M3WHW2_BCL2A1-02      atggccgacggcgagtttgggtacgttctcacgctggcccgggactatac
                      **************************************************

M3WHW2_BCL2A1-01      ggagcacgttctgcaggggccccagcccgggtcccacccaagcagagtat
M3WHW2_BCL2A1-02      ggagcacgttctgcaggggccccagcccgggtcccacccaagcagagtat
                      **************************************************

M3WHW2_BCL2A1-01      cccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaag
M3WHW2_BCL2A1-02      cccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaag
                      **************************************************

M3WHW2_BCL2A1-01      aagttgaagccgtgcctggacaagttccatgtggtgtcggtagacacggc
M3WHW2_BCL2A1-02      aagttgaagccgtgcctggacaagttccatgtggtgtcggtagacacggc
                      **************************************************

M3WHW2_BCL2A1-01      caggacgatattccaccaagtgatggaaaaggaatttgaagacggcatca
M3WHW2_BCL2A1-02      caggacgatattccaccaagtgatggaaaaggaatttgaagacggcatca
                      **************************************************

M3WHW2_BCL2A1-01      ttaactggggcaggattgtgactatatttgcgtttgagggcatcctcatc
M3WHW2_BCL2A1-02      ttaactggggcaggattgtgactatatttgcgtttgagggcatcctcatc
                      **************************************************

M3WHW2_BCL2A1-01      aagaagcttctccaggagcggatcgtcccagacgcggatgcgtttaaggt
M3WHW2_BCL2A1-02      aagaagcttctccaggagcggatcgtcccagacgcggatgcgtttaaggt
                      **************************************************

M3WHW2_BCL2A1-01      ttcctactttgtcgccgagttcatcacgaaacacacgggagaatggatcc
M3WHW2_BCL2A1-02      ttcctactttgtcgccgagttcatcacgaaacacacgggagaatggatcc
                      **************************************************

M3WHW2_BCL2A1-01      ggcaaaacggaggctgggaaaacggctttgtaaggaagttcgaacccaag
M3WHW2_BCL2A1-02      ggcaaaacggaggctggca------ctcagta--------------caag
                      ***************** *      **  ***              ****

M3WHW2_BCL2A1-01      tctggctggctgacctttctggaagttacaggaaagatctgtaaggtatt
M3WHW2_BCL2A1-02      tttag---------------------------------------------
                      * * *                                             

M3WHW2_BCL2A1-01      gtctctcctgaagaactactactga
M3WHW2_BCL2A1-02      -------------------------
                                               

© 1998-2018