Dataset for CDS MCL-1 of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8Y1W8_MCL1-02      atgaacctgtcgaaatcgcttacacgagccacaactacgatgctcaacgt
A0A3P8Y1W8_MCL1-01      atgaacctgtcgaaatcgcttacacgagccacaactacgatgctcaacgt
                        **************************************************

A0A3P8Y1W8_MCL1-02      tcaaaatggagtcgtgggatctttgtattctggtgcccctttgtgctatt
A0A3P8Y1W8_MCL1-01      tcaaaatggagtcgtgggatctttgtattctggtgcccctttgtgctatt
                        **************************************************

A0A3P8Y1W8_MCL1-02      ttagcccgacagggcccttatgtcctgcggcctcttcgaagtccaaaatg
A0A3P8Y1W8_MCL1-01      ttagcccgacagggcccttatgtcctgcggcctcttcgaagtccaaaatg
                        **************************************************

A0A3P8Y1W8_MCL1-02      gacgttgatttaggaaatgggactgctgatactcctgtccgacctacgaa
A0A3P8Y1W8_MCL1-01      gacgttgatttaggaaatgggactgctgatactcctgtccgacctacgaa
                        **************************************************

A0A3P8Y1W8_MCL1-02      gttagaagtaaatatgacgaaacccaacgtattggatagtcgtttgtcag
A0A3P8Y1W8_MCL1-01      gttagaagtaaatatgacgaaacccaacgtattggatagtcgtttgtcag
                        **************************************************

A0A3P8Y1W8_MCL1-02      acctggccgacgactccgacgactcattgccgtgcactcccctgatggtt
A0A3P8Y1W8_MCL1-01      acctggccgacgactccgacgactcattgccgtgcactcccctgatggtt
                        **************************************************

A0A3P8Y1W8_MCL1-02      actgagtgtagtgcggggttatcacattgcccatcgggcaatgaggtttt
A0A3P8Y1W8_MCL1-01      actgagtgtagtgcggggttatcacattgcccatcgggcaatgaggtttt
                        **************************************************

A0A3P8Y1W8_MCL1-02      ggacaacgataccagacaactcattgagaatttattaagggactacacag
A0A3P8Y1W8_MCL1-01      ggacaacgataccagacaactcattgagaatttattaagggactacacag
                        **************************************************

A0A3P8Y1W8_MCL1-02      gactgtctcaacctcgttggaaacaaaacaagtctcttgtgacgatgaaa
A0A3P8Y1W8_MCL1-01      gactgtctcaacctcgttggaaacaaaacaagtctcttgtgacgatgaaa
                        **************************************************

A0A3P8Y1W8_MCL1-02      agagtggtgggcgacgtaatagccaagcacacatacgcatacaagggtat
A0A3P8Y1W8_MCL1-01      agagtggtgggcgacgtaatagccaagcacacatacgcatacaagggtat
                        **************************************************

A0A3P8Y1W8_MCL1-02      gatctccaaactttgcttggatgatcaaggggatgacatgggtttcatca
A0A3P8Y1W8_MCL1-01      gatctccaaactttgcttggatgatcaaggggatgacatgggtttcatca
                        **************************************************

A0A3P8Y1W8_MCL1-02      cgtctgtggccaagagtctgttcagtgatgggactacaaactggggtcgc
A0A3P8Y1W8_MCL1-01      cgtctgtggccaagagtctgttcagtgatgggactacaaactggggtcgc
                        **************************************************

A0A3P8Y1W8_MCL1-02      attgccagcttggtgggctttggggcagtagtgagtcaacacctgaagga
A0A3P8Y1W8_MCL1-01      attgccagcttggtgggctttggggcagtagtgagtcaacacctgaagga
                        **************************************************

A0A3P8Y1W8_MCL1-02      gatgggcaagggaaactgcgttgagttggttggccaagaaatctccacat
A0A3P8Y1W8_MCL1-01      gatgggcaagggaaactgcgttgagttggttggccaagaaatctccacat
                        **************************************************

A0A3P8Y1W8_MCL1-02      acctcctcactgaccaaagggcctggctcgtgaaaaacaacgcttgggat
A0A3P8Y1W8_MCL1-01      acctcctcactgaccaaagggcctggctcgtgaaaaacaacgcttgggat
                        **************************************************

A0A3P8Y1W8_MCL1-02      ggatttgtagagttttttcatgtagaagatccagagtcctcacc------
A0A3P8Y1W8_MCL1-01      ggatttgtagagttttttcatgtagaagatccagagtcctcagtaaggaa
                        ******************************************        

A0A3P8Y1W8_MCL1-02      ------------------------------gattgg------actattcc
A0A3P8Y1W8_MCL1-01      cacccttatggcctttgcaggagttgctggaattggggcaacacttgccc
                                                       *****      ***   **

A0A3P8Y1W8_MCL1-02      tgcaagttttctga
A0A3P8Y1W8_MCL1-01      tgttaatcaggtga
                        **  * *    ***

© 1998-2019