Dataset for CDS BCL-2-like of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8Y1W8_MCL1-01      atgaacctgtcgaaatcgcttacacgagccacaactacgatgctcaacgt
A0A3P8Y1W8_MCL1-02      atgaacctgtcgaaatcgcttacacgagccacaactacgatgctcaacgt
A0A3P8XYL5_BCL2L1-      atga--------------cttaca--------------------------
A0A3P8XFS0_BCL2L1-      atgt--------------cttaca--------------------------
A0A3P8XFS0_BCL2L1-      atgt--------------cttaca--------------------------
A0A3P8YNB4_BCL2-01      atgg--cagacg---------acg--------------------------
A0A3P9AAB2_BCL2-01      atgg--caaacgagaatccatatg--------------------------
                        ***                  *                            

A0A3P8Y1W8_MCL1-01      tcaaaatggagtcgtgggatctttgtattctggtgcccctttgtgctatt
A0A3P8Y1W8_MCL1-02      tcaaaatggagtcgtgggatctttgtattctggtgcccctttgtgctatt
A0A3P8XYL5_BCL2L1-      acaacaaagaactggtggcatactatatt-------acctataaactatc
A0A3P8XFS0_BCL2L1-      gtaatagggaactggtggtgttttttata-------aactataaactgtc
A0A3P8XFS0_BCL2L1-      gtaatagggaactggtggtgttttttata-------aactataaactgtc
A0A3P8YNB4_BCL2-01      ataaccgttttatagtggaaaagtacatt-------tgtcacaaactctt
A0A3P9AAB2_BCL2-01      acagtcgcgtcattgtcgaaaattacatc-------tatgataaactgtt
                          *              *     *  **                 ** * 

A0A3P8Y1W8_MCL1-01      ttagcccgacagggccc-ttatgtcctgcggcctcttcgaagtccaaaat
A0A3P8Y1W8_MCL1-02      ttagcccgacagggccc-ttatgtcctgcggcctcttcgaagtccaaaat
A0A3P8XYL5_BCL2L1-      ccagagaaactaccccatcaatcacactgggc----tcacaggagcattt
A0A3P8XFS0_BCL2L1-      ccagaggaattattcctgttgtgaattggagc----tggagggtgcaagt
A0A3P8XFS0_BCL2L1-      ccagaggaattattcctgttgtgaattggagc----tggagggtgcaagt
A0A3P8YNB4_BCL2-01      aaaacggggatatgcat------------ggg-atttcgaagatgcagag
A0A3P9AAB2_BCL2-01      gaagaatggatttgttt------------gggaatttcaaa----cagag
                          *                           *     *         *   

A0A3P8Y1W8_MCL1-01      ggacgttgatttagg----------aaatgggactgctgatactcctgtc
A0A3P8Y1W8_MCL1-02      ggacgttgatttagg----------aaatgggactgctgatactcctgtc
A0A3P8XYL5_BCL2L1-      gatcg--gactgaggggggagaggtggaagaggtggcagcagtcaccatg
A0A3P8XFS0_BCL2L1-      ggacg--gactgaggg---------agaagaggctactgca---------
A0A3P8XFS0_BCL2L1-      ggacg--gactgaggg---------agaagaggctactgca---------
A0A3P8YNB4_BCL2-01      gagga--agatggtgc---------taataatgg-gtcgatgatttctc-
A0A3P9AAB2_BCL2-01      aacca--atctcg------------aaataacgtctttgaggatccctct
                                  *                *          *           

A0A3P8Y1W8_MCL1-01      cgacctacgaagttagaa--gtaaatatgacgaaaccc------------
A0A3P8Y1W8_MCL1-02      cgacctacgaagttagaa--gtaaatatgacgaaaccc------------
A0A3P8XYL5_BCL2L1-      caccccaatggcac---a--atgaatgggacgagtcct------------
A0A3P8XFS0_BCL2L1-      ------aatgggtc---t--gtgg--ggaacgg---ca------------
A0A3P8XFS0_BCL2L1-      ------aatgggtc---t--gtgg--ggaacgg---ca------------
A0A3P8YNB4_BCL2-01      --------ctccgccggg--tttggtacggcggattca---tggggccag
A0A3P9AAB2_BCL2-01      ccccccaactcccccgaactttttgcacggaggctccaacctcccgcc--
                                             *         *    *             

A0A3P8Y1W8_MCL1-01      ----aacgtattggatagtcgtttgtcagacctggccgacgactccgacg
A0A3P8Y1W8_MCL1-02      ----aacgtattggatagtcgtttgtcagacctggccgacgactccgacg
A0A3P8XYL5_BCL2L1-      ----g-------ggactc--------ca-ac-------acaac-------
A0A3P8XFS0_BCL2L1-      ----g-------gaacag--------cagac-------gcaatttgggaa
A0A3P8XFS0_BCL2L1-      ----g-------gaacag--------cagac-------gcaatttgggaa
A0A3P8YNB4_BCL2-01      taaagccggacagggcag-cgttccccatat-----------ttccaaat
A0A3P9AAB2_BCL2-01      ----gctggcgaggacaa-cgaccctcagtt-----------cgcaaata
                                    *             **                      

A0A3P8Y1W8_MCL1-01      actcattgccgtgcactcccctgatggtta-----ctgagtgtagtgcgg
A0A3P8Y1W8_MCL1-02      actcattgccgtgcactcccctgatggtta-----ctgagtgtagtgcgg
A0A3P8XYL5_BCL2L1-      agtcccccccctcatctcctcggcggactgttggcctggatgcagtgaaa
A0A3P8XFS0_BCL2L1-      ag------ccctcaactccacagggg------tgcatggaggcagtgaaa
A0A3P8XFS0_BCL2L1-      ag------ccctcaactccacagggg------tgcatggaggcagtgaaa
A0A3P8YNB4_BCL2-01      ggctctcccaaccagacccgca----------tgcagctattcacagagt
A0A3P9AAB2_BCL2-01      ggatcccgcaaccggacccgca----------cgcccggctccacagagt
                                *        ** *                      *  *   

A0A3P8Y1W8_MCL1-01      ggttatcacattgcccatcgggcaatgaggttttggacaacg--atacca
A0A3P8Y1W8_MCL1-02      ggttatcacattgcccatcgggcaatgaggttttggacaacg--atacca
A0A3P8XYL5_BCL2L1-      g--aggcactgcgggactctgccaacgag--tttgagctgcgttacgccc
A0A3P8XFS0_BCL2L1-      g--cagcactacgggactctgcagatgag--tttgagctgcgctacaccc
A0A3P8XFS0_BCL2L1-      g--cagcactacgggactctgcagatgag--tttgagctgcgctacaccc
A0A3P8YNB4_BCL2-01      g-------ttgcgtgaggccggggacgaa--ctcgaaagactgtaccaac
A0A3P9AAB2_BCL2-01      c-------ctccgcgatgccgggaacgag--atcgaaagaatgtatcagc
                                    *     * *   * **    * *         *     

A0A3P8Y1W8_MCL1-01      gacaactcattgagaatttattaagggactacacaggactgtctcaacct
A0A3P8Y1W8_MCL1-02      gacaactcattgagaatttattaagggactacacaggactgtctcaacct
A0A3P8XYL5_BCL2L1-      tagcattcagtgacctgtcat----------cccagctgcacctcacacc
A0A3P8XFS0_BCL2L1-      gtgccttcagtgatctctcct----------cccagctccacatcacccc
A0A3P8XFS0_BCL2L1-      gtgccttcagtgatctctcct----------cccagctccacatcacccc
A0A3P8YNB4_BCL2-01      ccgactttttggagatgtcac----------accagctgtatctgacgtc
A0A3P9AAB2_BCL2-01      gggactttgcagagatgtcgg----------ggcagttgcatattacgcc
                              *    **    *               ***       * *    

A0A3P8Y1W8_MCL1-01      cgttggaaacaaaacaagtctcttgtgacgatgaaaagagtggtgggcga
A0A3P8Y1W8_MCL1-02      cgttggaaacaaaacaagtctcttgtgacgatgaaaagagtggtgggcga
A0A3P8XYL5_BCL2L1-      ggct----------------------------------------------
A0A3P8XFS0_BCL2L1-      cgcc----------------------------------------------
A0A3P8XFS0_BCL2L1-      cgcc----------------------------------------------
A0A3P8YNB4_BCL2-01      ctct----------------------------------------------
A0A3P9AAB2_BCL2-01      cagc----------------------------------------------
                                                                          

A0A3P8Y1W8_MCL1-01      cgtaatagccaagcacacatacgcatacaagggtatgatctccaaacttt
A0A3P8Y1W8_MCL1-02      cgtaatagccaagcacacatacgcatacaagggtatgatctccaaacttt
A0A3P8XYL5_BCL2L1-      ----acagcctaccag----------------------------agcttt
A0A3P8XFS0_BCL2L1-      ----acagcctaccac----------------------------agtttt
A0A3P8XFS0_BCL2L1-      ----acagcctaccac----------------------------agtttt
A0A3P8YNB4_BCL2-01      ----gtggccgagagg----------------------------agattc
A0A3P9AAB2_BCL2-01      ----acggcacatgga----------------------------cgattt
                               **  *                                   ** 

A0A3P8Y1W8_MCL1-01      gcttggatgatcaaggggatgacatgggtttcatcacgtctgtggccaag
A0A3P8Y1W8_MCL1-02      gcttggatgatcaaggggatgacatgggtttcatcacgtctgtggccaag
A0A3P8XYL5_BCL2L1-      gcaagtgtgatggatgagg-------------------------------
A0A3P8XFS0_BCL2L1-      gaaagtgtgatggacgagg-------------------------------
A0A3P8XFS0_BCL2L1-      gaaagtgtgatggacgagg-------------------------------
A0A3P8YNB4_BCL2-01      agagaggttatagacgagc-------------------------------
A0A3P9AAB2_BCL2-01      accgcagtaatagacgaac-------------------------------
                               * **  * *                                  

A0A3P8Y1W8_MCL1-01      agtctgttcagtgatgggactacaaactggggtcgcattgccagcttggt
A0A3P8Y1W8_MCL1-02      agtctgttcagtgatgggactacaaactggggtcgcattgccagcttggt
A0A3P8XYL5_BCL2L1-      ----tgttccgggatggggtg---aactggggaagggttgtgggcctgtt
A0A3P8XFS0_BCL2L1-      ----tgttcagggatggggtt---aactggggtcgtgtggtgggcctgtt
A0A3P8XFS0_BCL2L1-      ----tgttcagggatggggtt---aactggggtcgtgtggtgggcctgtt
A0A3P8YNB4_BCL2-01      ----tgttcagagacggagtt---aactggggacgtattatcgctttctt
A0A3P9AAB2_BCL2-01      ----tgttcagcgacggtgta---aactggggtcggattgtggctttcct
                            ***** * ** **       ********  *  *        *  *

A0A3P8Y1W8_MCL1-01      gggctttggggcagt-----------agtgagtcaacacctgaaggagat
A0A3P8Y1W8_MCL1-02      gggctttggggcagt-----------agtgagtcaacacctgaaggagat
A0A3P8XYL5_BCL2L1-      tgcgttcggaggggccctctgtgtagagtgcgtgga-----gaaggagat
A0A3P8XFS0_BCL2L1-      tgctttcggcggggccctatgtgttgagtgtgttga-----gaaggatat
A0A3P8XFS0_BCL2L1-      tgctttcggcggggccctatgtgttgagtgtgttga-----gaaggatat
A0A3P8YNB4_BCL2-01      cgagttcgggggcacaatatgcgtggaatgcgtgaa-----caaggaaat
A0A3P9AAB2_BCL2-01      tgagtttggagggacaatgtgcgtggagagcgtcaa-----ccgggagat
                         *  ** ** *               *  * **  *        *** **

A0A3P8Y1W8_MCL1-01      gggcaagggaaactgcgttgagttggttggccaagaaatctccacatacc
A0A3P8Y1W8_MCL1-02      gggcaagggaaactgcgttgagttggttggccaagaaatctccacatacc
A0A3P8XYL5_BCL2L1-      gagc------ccccttgtgggacggattgctgactggatgaccgtctacc
A0A3P8XFS0_BCL2L1-      gagc------ctcctagtggcacgtattgcagactggatgaccacctacc
A0A3P8XFS0_BCL2L1-      gagc------ctcctagtggcacgtattgcagactggatgaccacctacc
A0A3P8YNB4_BCL2-01      gact------tcgcaggtggaccacattgccgggtggatgacagaatatc
A0A3P9AAB2_BCL2-01      gacg------ccccaggtgaacaacatcgtccattggatgacggagtacc
                        *               **        * *        **  *    ** *

A0A3P8Y1W8_MCL1-01      tcctcactgaccaaagggcctggctcgtgaaaaacaacgcttgggatgga
A0A3P8Y1W8_MCL1-02      tcctcactgaccaaagggcctggctcgtgaaaaacaacgcttgggatgga
A0A3P8XYL5_BCL2L1-      tggataaccacatccagccctggatcgagagccaaggaggatgggaccgt
A0A3P8XFS0_BCL2L1-      tggacgaacacatccagccctggatccaaattcaaggaggatgggatcgt
A0A3P8XFS0_BCL2L1-      tggacgaacacatccagccctggatccaaattcaaggaggatgggatcgt
A0A3P8YNB4_BCL2-01      taaatggacccctgcacagctggattcaagaaaacgggggatgggaggcc
A0A3P9AAB2_BCL2-01      tgaatggacccctgcaaaactggatccaggagaatggtggatgggatgct
                        *         *        **** *        *    *  *****    

A0A3P8Y1W8_MCL1-01      tttgtagagttttttcat----gtagaag-----------atccagagtc
A0A3P8Y1W8_MCL1-02      tttgtagagttttttcat----gtagaag-----------atccagagtc
A0A3P8XYL5_BCL2L1-      tttgcagagatctttggg----aaggatgctgcagccaacagcaggaagt
A0A3P8XFS0_BCL2L1-      tttgctgacatttttggc----agagatgcagctgcagacatccgacgtt
A0A3P8XFS0_BCL2L1-      tttgctgacatttttggc----agagatgcagctgcagacatccgacgtt
A0A3P8YNB4_BCL2-01      tttgtggagctctatgacagacagagggactctgtgttctgttcatggcc
A0A3P9AAB2_BCL2-01      ttcgtggagatctatgggcagaagaggggctctctcttccattcatggcc
                        ** *  **  * * *          *                        

A0A3P8Y1W8_MCL1-01      ctcagtaaggaacacccttatggcctttgcaggagttgctg-gaattggg
A0A3P8Y1W8_MCL1-02      ctcacc-------------------------------------gattgg-
A0A3P8XYL5_BCL2L1-      ctcaggagag---------------ctttaagaagtggctgctggcagga
A0A3P8XFS0_BCL2L1-      cccaagaaag---------------cttgaggaaatggctgctatttggg
A0A3P8XFS0_BCL2L1-      cccaagaaag---------------cttgaggaaatggctgctatttggg
A0A3P8YNB4_BCL2-01      ctccatcaag------------actgtctttggcctggctgcactggggg
A0A3P9AAB2_BCL2-01      tttcctcaag------------accatgtttagcttggccgccctggggg
                                                                       ** 

A0A3P8Y1W8_MCL1-01      gcaacacttgccctgttaatcagg--------------------------
A0A3P8Y1W8_MCL1-02      -----actattcctgcaagttttc--------------------------
A0A3P8XYL5_BCL2L1-      atgacgctggttacaggagttgtcgttgggtctcttattgctcagaaacg
A0A3P8XFS0_BCL2L1-      atg--------------------------------------gaaaatgcg
A0A3P8XFS0_BCL2L1-      gtgatgctgctttcaggagtgctggttggcactctcctcatgaagaaacg
A0A3P8YNB4_BCL2-01      ctg----------caagcctcaccattggagcataccttacacagaag--
A0A3P9AAB2_BCL2-01      cag----------ctggagtcaccattggagccatgttcacccagaag--
                                                                          

A0A3P8Y1W8_MCL1-01      ---------tga
A0A3P8Y1W8_MCL1-02      ---------tga
A0A3P8XYL5_BCL2L1-      cctg-----tga
A0A3P8XFS0_BCL2L1-      caatggacctga
A0A3P8XFS0_BCL2L1-      ccag-----taa
A0A3P8YNB4_BCL2-01      ---------tga
A0A3P9AAB2_BCL2-01      ---------tga
                                 * *

© 1998-2019