Dataset for CDS BCL-2-like of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7CP56_BCL2A1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-02        --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
F7AVA6_MCL1-01          atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgg
                                                                          

F7CP56_BCL2A1-01        --------------------atgac-------------------------
F6WQI0_BCL2L1-01        --------------------atgtctcag---------------------
F6WQI0_BCL2L1-02        --------------------atgtctcag---------------------
A0A3Q2HRY3_BCL2-02      --------------------atggcgcacgc-----------tgggagaa
A0A3Q2HRY3_BCL2-01      --------------------atggcgcacgc-----------tgggagaa
F6PH48_BCL2L2-01        --------------------atggcgaccccagcctcagccccagacaca
F6ZPD4_BCL2L10-01       --------------------gtggcggaggc-gct---------------
F7AVA6_MCL1-01          gggggccgggttgggggccggcggcggcggc-gcctcgtcgccgggaggg
                                              * *                         

F7CP56_BCL2A1-01        ----------cgactgtgagtttggatata---------ttcacat----
F6WQI0_BCL2L1-01        --------agcaaccgggagctggtggttgactttctctcctacaa----
F6WQI0_BCL2L1-02        --------agcaaccgggagctggtggttgactttctctcctacaa----
A0A3Q2HRY3_BCL2-02      cagggtatgataaccgggagatagtgatgaagtacatccactataa----
A0A3Q2HRY3_BCL2-01      cagggtatgataaccgggagatagtgatgaagtacatccactataa----
F6PH48_BCL2L2-01        cgggctctagtggca--gactttgtag------------gctataa----
F6ZPD4_BCL2L10-01       -----------------ga---gggag------------cgcacggc---
F7AVA6_MCL1-01          cggcttttggctgcgggga---aggag------------gccacggcccg
                                         **    *                  *       

F7CP56_BCL2A1-01        ----------------------gctggcccag---gact-----------
F6WQI0_BCL2L1-01        ----------------------gctttcccagaaaggatacaactggagt
F6WQI0_BCL2L1-02        ----------------------gctttcccagaaaggatacaactggagt
A0A3Q2HRY3_BCL2-02      ----------------------gctgtcgcagaggggctacgagtgggat
A0A3Q2HRY3_BCL2-01      ----------------------gctgtcgcagaggggctacgagtgggat
F6PH48_BCL2L2-01        ----------------------gctgaggcagaagggtt---------at
F6ZPD4_BCL2L10-01       ----------------------gctactgctgatcgac-----------t
F7AVA6_MCL1-01          gcgagagggagggggaggggaggccggcgcgg--tgat-----------t
                                              **     * *   *              

F7CP56_BCL2A1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        cagtttagtgacgtggaagagaacagaactgaggccccagaagggactga
F6WQI0_BCL2L1-02        cagtttagtgacgtggaagagaacagaactgaggccccagaagggactga
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
F6PH48_BCL2L2-01        --------------------------------------------------
F6ZPD4_BCL2L10-01       --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
                                                                          

F7CP56_BCL2A1-01        acctgaagtacgtcctgcagatacc------------acaacctggatct
F6WQI0_BCL2L1-01        atcagagatggagacccccagtgccatcaatggcaacccatcctggcacc
F6WQI0_BCL2L1-02        atcagagatggagacccccagtgccatcaatggcaacccatcctggcacc
A0A3Q2HRY3_BCL2-02      gccggagacgcgggcgccgcgcccc------tgggggccacccccgtgcc
A0A3Q2HRY3_BCL2-01      gccggagacgcgggcgccgcgcccc------tgggggccacccccgtgcc
F6PH48_BCL2L2-01        gtttgtggagctggccccggggagg----------gcccagccgctgacc
F6ZPD4_BCL2L10-01       acctgcagcgccgcgcccgggagcc----------ggccacgcccgaggt
F7AVA6_MCL1-01          ggcggaagcgccg---gcgggagcc------cccagaccaccctcgcgcc
                            *            *                    **  *       

F7CP56_BCL2A1-01        gg-----------------------------------tccaagcaaaaca
F6WQI0_BCL2L1-01        tg----------------------------------------gcggacag
F6WQI0_BCL2L1-02        tg----------------------------------------gcggacag
A0A3Q2HRY3_BCL2-02      gggcatcttctcctcccagcccgggcgcacccccgcgcccgccaggacct
A0A3Q2HRY3_BCL2-01      gggcatcttctcctcccagcccgggcgcacccccgcgcccgccaggacct
F6PH48_BCL2L2-01        ca---------------------------------------------ctg
F6ZPD4_BCL2L10-01       gg---------------------------------------------ccg
F7AVA6_MCL1-01          gg---------------------------------------------act
                                                                          

F7CP56_BCL2A1-01        tccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaa
F6WQI0_BCL2L1-01        ccccacggggaatggagc----cactggccacagcagc--------ag--
F6WQI0_BCL2L1-02        ccccacggggaatggagc----cactggccacagcagc--------ag--
A0A3Q2HRY3_BCL2-02      ccccgctgctacccccgg----ccgcccccgccggcgccgcg----gg--
A0A3Q2HRY3_BCL2-01      ccccgctgctacccccgg----ccgcccccgccggcgccgcg----gg--
F6PH48_BCL2L2-01        caccaa--gccatgcggg----------cagctggagatgagtttgag--
F6ZPD4_BCL2L10-01       tgctgc--gctgcgtggc-----------------cgcccagatacag--
F7AVA6_MCL1-01          ccctgagggtcgcgcggc----cctcccccattggcgccgag----gg--
                          *                                            *  

F7CP56_BCL2A1-01        gaatttgaaaccatgcttggacaatttt----------------------
F6WQI0_BCL2L1-01        --cttggatgcccgggaagtgatccccatggcagcagtgaagcaagcgct
F6WQI0_BCL2L1-02        --cttggatgcccgggaagtgatccccatggcagcagtgaagcaagcgct
A0A3Q2HRY3_BCL2-02      --acctgccctcagccctgtgccacctgtggtccacctga------ccct
A0A3Q2HRY3_BCL2-01      --acctgccctcagccctgtgccacctgtggtccacctga------ccct
F6PH48_BCL2L2-01        --acccgcttccggc---gcaccttctc---------tga------tctg
F6ZPD4_BCL2L10-01       --ccccgcaaccagc---g------------------tgt------tctt
F7AVA6_MCL1-01          --ccccgacgtcacc---gcgccctcctccaggctgctgt------tctt
                              *    *      *                               

F7CP56_BCL2A1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        gagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcg
F6WQI0_BCL2L1-02        gagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcg
A0A3Q2HRY3_BCL2-02      gcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccg
A0A3Q2HRY3_BCL2-01      gcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccg
F6PH48_BCL2L2-01        gc------------------------------------------------
F6ZPD4_BCL2L10-01       t-------------------------------------------------
F7AVA6_MCL1-01          cg------------------------------------------------
                                                                          

F7CP56_BCL2A1-01        ----------catgttgtg-----------------------tccataga
F6WQI0_BCL2L1-01        acctgacatcccagctccacatc-------------------accccagg
F6WQI0_BCL2L1-02        acctgacatcccagctccacatc-------------------accccagg
A0A3Q2HRY3_BCL2-02      agatgtccagccagctgcacctg-------------------acgccttt
A0A3Q2HRY3_BCL2-01      agatgtccagccagctgcacctg-------------------acgccttt
F6PH48_BCL2L2-01        ----ggc---tcagctgcatgtg-------------------accccggg
F6ZPD4_BCL2L10-01       ----------cccgct--------------------------accgcggc
F7AVA6_MCL1-01          ----cgcccacccgctgcgcgtcgccgcctgaggggatggaagccccggc
                                     * *                           *      

F7CP56_BCL2A1-01        tgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaagatg
F6WQI0_BCL2L1-01        gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
F6WQI0_BCL2L1-02        gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
A0A3Q2HRY3_BCL2-02      caccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
A0A3Q2HRY3_BCL2-01      caccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
F6PH48_BCL2L2-01        ctcagcccagcaacgcttcacccaggtctctgacgaactcttccaaggtg
F6ZPD4_BCL2L10-01       ttccg-cggggaccacgtc------gggctggcggcacggatg-gcgcag
F7AVA6_MCL1-01          cgccg-acgccatcatgtcgcccgaggaggagctggacgggtacgagccg
                          * *            *       *           *   *    *  *

F7CP56_BCL2A1-01        gca--------------------------tcattaactgggg-----aag
F6WQI0_BCL2L1-01        ggg-----------------------------tgaactgggg-----tcg
F6WQI0_BCL2L1-02        ggg-----------------------------tgaactgggg-----tcg
A0A3Q2HRY3_BCL2-02      ggg-----------------------------tgaactgggg-----gag
A0A3Q2HRY3_BCL2-01      ggg-----------------------------tgaactgggg-----gag
F6PH48_BCL2L2-01        g-----------------------------ccccaactgggg-----ccg
F6ZPD4_BCL2L10-01       gcgatcttcggagaccgccacgt-------ccccagctgggg-----ccg
F7AVA6_MCL1-01          gagcctctcgggaagcggccggctgtcctgcccttgctggagtttgtccg
                        *                                   **** *       *

F7CP56_BCL2A1-01        aattatgaccatatttgcatttgaaggtattc------------------
F6WQI0_BCL2L1-01        cattgtggcctttttctccttcggtgggg---------------------
F6WQI0_BCL2L1-02        cattgtggcctttttctccttcggtgggg---------------------
A0A3Q2HRY3_BCL2-02      gattgtggccttctttgagttcggtggggtca------------------
A0A3Q2HRY3_BCL2-01      gattgtggccttctttgagttcggtggggtca------------------
F6PH48_BCL2L2-01        ccttgtggccttc-tttgtctttg--gagccg------------------
F6ZPD4_BCL2L10-01       cgtggcggcgctc-gtgaccctggcggggacg------------------
F7AVA6_MCL1-01          ggaggc--cagca-gtggcccctgcacggacggctcgctcccctcgacgc
                                *                                         

F7CP56_BCL2A1-01        ------------------------------tcatcaagaaacttctacca
F6WQI0_BCL2L1-01        ------------------------------------------cactgtgc
F6WQI0_BCL2L1-02        ------------------------------------------cactgtgc
A0A3Q2HRY3_BCL2-02      ---------------------------------------------tgtgt
A0A3Q2HRY3_BCL2-01      ---------------------------------------------tgtgt
F6PH48_BCL2L2-01        ------------------------------------------cgctgtgt
F6ZPD4_BCL2L10-01       -----------------------------------------ctgctg---
F7AVA6_MCL1-01          cgcccccagcagaggaggaggaggacgagttgtaccggcaatcgctg---
                                                                     *    

F7CP56_BCL2A1-01        gagcgaattgcccc-----------------------------------a
F6WQI0_BCL2L1-01        gtggaaagcgta------------------------------gacaagga
F6WQI0_BCL2L1-02        gtggaaagcgta------------------------------gacaagga
A0A3Q2HRY3_BCL2-02      gtggagagcgtc------------------------------aaccggga
A0A3Q2HRY3_BCL2-01      gtggagagcgtc------------------------------aaccggga
F6PH48_BCL2L2-01        gctgagagtgtc------------------------------aacaagga
F6ZPD4_BCL2L10-01       ---gagagagccccgcg--------gggaac---ctaccgaaagc-----
F7AVA6_MCL1-01          ---gagattatctctcgttaccttcgggaacaggctaccggcaccaagga
                              *                                           

F7CP56_BCL2A1-01        gatgtggatacttacaa-----ggagatttcttactttgttgctgagttc
F6WQI0_BCL2L1-01        gatgcaggtattgg--------tgagtcggatcgcaacctggatggccac
F6WQI0_BCL2L1-02        gatgcaggtattgg--------tgagtcggatcgcaacctggatggccac
A0A3Q2HRY3_BCL2-02      gatgtcgcccctgg--------tggacaacatcgccctgtggatgactga
A0A3Q2HRY3_BCL2-01      gatgtcgcccctgg--------tggacaacatcgccctgtggatgactga
F6PH48_BCL2L2-01        gatggagccacttg--------tgggacaagtgcaggagtggatggtggc
F6ZPD4_BCL2L10-01       --cgaagc--------------ggggctacaagctggagctgagggag--
F7AVA6_MCL1-01          cacgaagccaatgggcgggtctggggccgccagccgga----aggcgt--
                           *  *                *                    *     

F7CP56_BCL2A1-01        ataacgaaaaacacagga----------gaatggataaggcaaaatggag
F6WQI0_BCL2L1-01        ttacctgaatgaccacctagagcct------tggatccaagagaacggcg
F6WQI0_BCL2L1-02        ttacctgaatgaccacctagagcct------tggatccaagagaacggcg
A0A3Q2HRY3_BCL2-02      atacctgaa---ccggcacctgcac---acctggatccaggataacggag
A0A3Q2HRY3_BCL2-01      atacctgaa---ccggcacctgcac---acctggatccaggataacggag
F6PH48_BCL2L2-01        ctacctggagactcggc---tggcc---gactggatccacagcagtggag
F6ZPD4_BCL2L10-01       -----tggaaggccggcg--tggaccgggactggctgcg----------c
F7AVA6_MCL1-01          -----tagagaccctgcggcgggtcggggacggagtgcagcgcaat---c
                                *    *                  *  *              

F7CP56_BCL2A1-01        gctgggaaaa----------------------------------------
F6WQI0_BCL2L1-01        gctgg---gacacctttgtgga----------------------------
F6WQI0_BCL2L1-02        gctggaaagaaactgctttggg----------------------------
A0A3Q2HRY3_BCL2-02      gctgg--caactttgccaagcaccaaca----------------------
A0A3Q2HRY3_BCL2-01      gctgggacgcctttgt---ggaactgta----------------------
F6PH48_BCL2L2-01        gctgggcggagttca-----------------------------------
F6ZPD4_BCL2L10-01       gcctggtggacttcctgtgcgca---------------------------
F7AVA6_MCL1-01          acgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaa
                         *  *                                             

F7CP56_BCL2A1-01        ----------------tggctttgtaaagaa-------------------
F6WQI0_BCL2L1-01        ----------------actctacgggaacaac------------------
F6WQI0_BCL2L1-02        ----------------gaccttctgctacttc------------------
A0A3Q2HRY3_BCL2-02      ----------------ggctctcaggaaatgt------------------
A0A3Q2HRY3_BCL2-01      ----------------cggccccagca-----------------------
F6PH48_BCL2L2-01        ----------------cagctctatacgggg-------------------
F6ZPD4_BCL2L10-01       ----------------tggctcaaggggcggc------------------
F7AVA6_MCL1-01          gacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacgg
                                                                          

F7CP56_BCL2A1-01        --------gtttgaacccaaatctggc-----------tggctgactttt
F6WQI0_BCL2L1-01        --------gcggcagcc-----gaaagcc---------ggaagggcca--
F6WQI0_BCL2L1-02        --------gtttcatccctgatgagactc---------tca--ggccaag
A0A3Q2HRY3_BCL2-02      --------tcagcggtgggtggaccattc-----attctggctctccatt
A0A3Q2HRY3_BCL2-01      ----------tgcggccgctgtttgattt-----ctcctggctgtctct-
F6PH48_BCL2L2-01        --------acggggccctggaggaggcgc--------------ggcgtct
F6ZPD4_BCL2L10-01       --------accgcgcctggctggaggctc-----actatggatggctttt
F7AVA6_MCL1-01          agtgacaaactggggcaggattgtgactcttatttcttttggt-gccttt
                                                                     *    

F7CP56_BCL2A1-01        ctgg----------------------------aagtt-------------
F6WQI0_BCL2L1-01        --gg-----------------------------agc--------------
F6WQI0_BCL2L1-02        gcgg-----------------------------agcctt-----------
A0A3Q2HRY3_BCL2-02      gcag-----aatctttgtgtgtcaagggcaggaaattgg-----------
A0A3Q2HRY3_BCL2-01      -------------------------------gaaggcgc-----------
F6PH48_BCL2L2-01        gcgg-----------------------gaggggaactgg-----------
F6ZPD4_BCL2L10-01       gtgacttctcactc------------------acactgc-----------
F7AVA6_MCL1-01          gtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccatt
                                                                          

F7CP56_BCL2A1-01        --------actggaaagatg--------tgtgaaatacttttcctga---
F6WQI0_BCL2L1-01        --------gcttcaa-------------ccgctggttcctgacg------
F6WQI0_BCL2L1-02        -acagctagctccaa-------------gctacagtgctttttg------
A0A3Q2HRY3_BCL2-02      --------ttttcagag-----------aagaaaaatatga-cttggtgt
A0A3Q2HRY3_BCL2-01      --------tgctcag---------------------tctggccctggtg-
F6PH48_BCL2L2-01        --------gcctcagtg-----------aggacagtgctgacaggggccg
F6ZPD4_BCL2L10-01       ------cagcttctcag-----------aggatactgctggtccggtttc
F7AVA6_MCL1-01          agcagaaagcatcacagatgtcctcgtaaggacaaaacgagactggctag
                                                                          

F7CP56_BCL2A1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        --------------------------------------------------
F6WQI0_BCL2L1-02        --------------------------------------------------
A0A3Q2HRY3_BCL2-02      ttaacttcagacaaggatgtaatcgacaggacacccatccgcatgtatca
A0A3Q2HRY3_BCL2-01      ----------------------------gga---------gcttgcatca
F6PH48_BCL2L2-01        t-------------------------------------------------
F6ZPD4_BCL2L10-01       t----------------------tctgtcat---------gcttttc---
F7AVA6_MCL1-01          tcaaacaaagaggctgggatgggtttgtgga---------gttcttccat
                                                                          

F7CP56_BCL2A1-01        ------------------agcaatactactga------------------
F6WQI0_BCL2L1-01        ------------------ggcatgactgtgg--------ctggt-----g
F6WQI0_BCL2L1-02        ------------------ggca-gactccagagct-cccctcggaactag
A0A3Q2HRY3_BCL2-02      gggaaggaagagtagagaggcagaaatacaaagccagtgcagacctccgt
A0A3Q2HRY3_BCL2-01      ------------------------------------------ccctgggt
F6PH48_BCL2L2-01        ------------------ggcattgg--------gggccctggtaactgt
F6ZPD4_BCL2L10-01       ------------------agcatcagtcttaatctacctctg--------
F7AVA6_MCL1-01          gtagaggacctagaaggtggcatcag---aaatgtgctgctggcttttgc
                                                                          

F7CP56_BCL2A1-01        --------------------------------------------------
F6WQI0_BCL2L1-01        tggttctgctgggctcactcttcagt--------c-------------gg
F6WQI0_BCL2L1-02        aggtttttct---ctcgctcttcaggaaatgccat-------------tg
A0A3Q2HRY3_BCL2-02      gcatgctgctgcacctgctggaaatccaggttccagttctgtttctcagt
A0A3Q2HRY3_BCL2-01      gcct-------------------atctgggccaca---------------
F6PH48_BCL2L2-01        aggggc--------------cttttttg------c-----------tagc
F6ZPD4_BCL2L10-01       ---------------------------gacaaaat-----------tatc
F7AVA6_MCL1-01          aggtgttgctggagtaggcgctggtttggcatatc-----------taat
                                                                          

F7CP56_BCL2A1-01        -------
F6WQI0_BCL2L1-01        aagtga-
F6WQI0_BCL2L1-02        caatga-
A0A3Q2HRY3_BCL2-02      gagtaa-
A0A3Q2HRY3_BCL2-01      -agtga-
F6PH48_BCL2L2-01        aagtga-
F6ZPD4_BCL2L10-01       atga---
F7AVA6_MCL1-01          aagatag
                               

© 1998-2019