Dataset for CDS BCL-2-like of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7CP56_BCL2A1-01       --------------------------------------------------
F6WQI0_BCL2L1-01       --------------------------------------------------
F6WQI0_BCL2L1-02       --------------------------------------------------
F7CDX6_BCL2-02         --------------------------------------------------
F7CDX6_BCL2-01         --------------------------------------------------
F6PH48_BCL2L2-01       --------------------------------------------------
F6ZPD4_BCL2L10-01      --------------------------------------------------
F7AVA6_MCL1-01         atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgg
                                                                         

F7CP56_BCL2A1-01       --------------------atgac-------------------------
F6WQI0_BCL2L1-01       --------------------atgtctcag---------------------
F6WQI0_BCL2L1-02       --------------------atgtctcag---------------------
F7CDX6_BCL2-02         --------------------atggcgcacgc-----------tgggagaa
F7CDX6_BCL2-01         --------------------atggcgcacgc-----------tgggagaa
F6PH48_BCL2L2-01       --------------------atggcgaccccagcctcagccccagacaca
F6ZPD4_BCL2L10-01      --------------------gtggcggaggc-gct---------------
F7AVA6_MCL1-01         gggggccgggttgggggccggcggcggcggc-gcctcgtcgccgggaggg
                                             * *                         

F7CP56_BCL2A1-01       ----------cgactgtgagtttggatata---------ttcacat----
F6WQI0_BCL2L1-01       --------agcaaccgggagctggtggttgactttctctcctacaa----
F6WQI0_BCL2L1-02       --------agcaaccgggagctggtggttgactttctctcctacaa----
F7CDX6_BCL2-02         cagggtatgataaccgggagatagtgatgaagtacatccactataa----
F7CDX6_BCL2-01         cagggtatgataaccgggagatagtgatgaagtacatccactataa----
F6PH48_BCL2L2-01       cgggctctagtggca--gactttgtag------------gctataa----
F6ZPD4_BCL2L10-01      -----------------ga---gggag------------cgcacggc---
F7AVA6_MCL1-01         cggcttttggctgcgggga---aggag------------gccacggcccg
                                        **    *                  *       

F7CP56_BCL2A1-01       ----------------------gctggcccag---gact-----------
F6WQI0_BCL2L1-01       ----------------------gctttcccagaaaggatacaactggagt
F6WQI0_BCL2L1-02       ----------------------gctttcccagaaaggatacaactggagt
F7CDX6_BCL2-02         ----------------------gctgtcgcagaggggctacgagtgggat
F7CDX6_BCL2-01         ----------------------gctgtcgcagaggggctacgagtgggat
F6PH48_BCL2L2-01       ----------------------gctgaggcagaagggtt---------at
F6ZPD4_BCL2L10-01      ----------------------gctactgctgatcgac-----------t
F7AVA6_MCL1-01         gcgagagggagggggaggggaggccggcgcgg--tgat-----------t
                                             **     * *   *              

F7CP56_BCL2A1-01       --------------------------------------------------
F6WQI0_BCL2L1-01       cagtttagtgacgtggaagagaacagaactgaggccccagaagggactga
F6WQI0_BCL2L1-02       cagtttagtgacgtggaagagaacagaactgaggccccagaagggactga
F7CDX6_BCL2-02         --------------------------------------------------
F7CDX6_BCL2-01         --------------------------------------------------
F6PH48_BCL2L2-01       --------------------------------------------------
F6ZPD4_BCL2L10-01      --------------------------------------------------
F7AVA6_MCL1-01         --------------------------------------------------
                                                                         

F7CP56_BCL2A1-01       acctgaagtacgtcctgcagatacc------------acaacctggatct
F6WQI0_BCL2L1-01       atcagagatggagacccccagtgccatcaatggcaacccatcctggcacc
F6WQI0_BCL2L1-02       atcagagatggagacccccagtgccatcaatggcaacccatcctggcacc
F7CDX6_BCL2-02         gccggagacgcgggcgccgcgcccc------tgggggccacccccgtgcc
F7CDX6_BCL2-01         gccggagacgcgggcgccgcgcccc------tgggggccacccccgtgcc
F6PH48_BCL2L2-01       gtttgtggagctggccccggggagg----------gcccagccgctgacc
F6ZPD4_BCL2L10-01      acctgcagcgccgcgcccgggagcc----------ggccacgcccgaggt
F7AVA6_MCL1-01         ggcggaagcgccg---gcgggagcc------cccagaccaccctcgcgcc
                           *            *                    **  *       

F7CP56_BCL2A1-01       gg-----------------------------------tccaagcaaaaca
F6WQI0_BCL2L1-01       tg----------------------------------------gcggacag
F6WQI0_BCL2L1-02       tg----------------------------------------gcggacag
F7CDX6_BCL2-02         gggcatcttctcctcccagcccgggcgcacccccgcgcccgccaggacct
F7CDX6_BCL2-01         gggcatcttctcctcccagcccgggcgcacccccgcgcccgccaggacct
F6PH48_BCL2L2-01       ca---------------------------------------------ctg
F6ZPD4_BCL2L10-01      gg---------------------------------------------ccg
F7AVA6_MCL1-01         gg---------------------------------------------act
                                                                         

F7CP56_BCL2A1-01       tccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaa
F6WQI0_BCL2L1-01       ccccacggggaatggagc----cactggccacagcagc--------ag--
F6WQI0_BCL2L1-02       ccccacggggaatggagc----cactggccacagcagc--------ag--
F7CDX6_BCL2-02         ccccgctgctacccccgg----ccgcccccgccggcgccgcg----gg--
F7CDX6_BCL2-01         ccccgctgctacccccgg----ccgcccccgccggcgccgcg----gg--
F6PH48_BCL2L2-01       caccaa--gccatgcggg----------cagctggagatgagtttgag--
F6ZPD4_BCL2L10-01      tgctgc--gctgcgtggc-----------------cgcccagatacag--
F7AVA6_MCL1-01         ccctgagggtcgcgcggc----cctcccccattggcgccgag----gg--
                         *                                            *  

F7CP56_BCL2A1-01       gaatttgaaaccatgcttggacaatttt----------------------
F6WQI0_BCL2L1-01       --cttggatgcccgggaagtgatccccatggcagcagtgaagcaagcgct
F6WQI0_BCL2L1-02       --cttggatgcccgggaagtgatccccatggcagcagtgaagcaagcgct
F7CDX6_BCL2-02         --acctgccctcagccctgtgccacctgtggtccacctga------ccct
F7CDX6_BCL2-01         --acctgccctcagccctgtgccacctgtggtccacctga------ccct
F6PH48_BCL2L2-01       --acccgcttccggc---gcaccttctc---------tga------tctg
F6ZPD4_BCL2L10-01      --ccccgcaaccagc---g------------------tgt------tctt
F7AVA6_MCL1-01         --ccccgacgtcacc---gcgccctcctccaggctgctgt------tctt
                             *    *      *                               

F7CP56_BCL2A1-01       --------------------------------------------------
F6WQI0_BCL2L1-01       gagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcg
F6WQI0_BCL2L1-02       gagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcg
F7CDX6_BCL2-02         gcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccg
F7CDX6_BCL2-01         gcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccg
F6PH48_BCL2L2-01       gc------------------------------------------------
F6ZPD4_BCL2L10-01      t-------------------------------------------------
F7AVA6_MCL1-01         cg------------------------------------------------
                                                                         

F7CP56_BCL2A1-01       ----------catgttgtg-----------------------tccataga
F6WQI0_BCL2L1-01       acctgacatcccagctccacatc-------------------accccagg
F6WQI0_BCL2L1-02       acctgacatcccagctccacatc-------------------accccagg
F7CDX6_BCL2-02         agatgtccagccagctgcacctg-------------------acgccttt
F7CDX6_BCL2-01         agatgtccagccagctgcacctg-------------------acgccttt
F6PH48_BCL2L2-01       ----ggc---tcagctgcatgtg-------------------accccggg
F6ZPD4_BCL2L10-01      ----------cccgct--------------------------accgcggc
F7AVA6_MCL1-01         ----cgcccacccgctgcgcgtcgccgcctgaggggatggaagccccggc
                                    * *                           *      

F7CP56_BCL2A1-01       tgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaagatg
F6WQI0_BCL2L1-01       gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
F6WQI0_BCL2L1-02       gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
F7CDX6_BCL2-02         caccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
F7CDX6_BCL2-01         caccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
F6PH48_BCL2L2-01       ctcagcccagcaacgcttcacccaggtctctgacgaactcttccaaggtg
F6ZPD4_BCL2L10-01      ttccg-cggggaccacgtc------gggctggcggcacggatg-gcgcag
F7AVA6_MCL1-01         cgccg-acgccatcatgtcgcccgaggaggagctggacgggtacgagccg
                         * *            *       *           *   *    *  *

F7CP56_BCL2A1-01       gca--------------------------tcattaactgggg-----aag
F6WQI0_BCL2L1-01       ggg-----------------------------tgaactgggg-----tcg
F6WQI0_BCL2L1-02       ggg-----------------------------tgaactgggg-----tcg
F7CDX6_BCL2-02         ggg-----------------------------tgaactgggg-----gag
F7CDX6_BCL2-01         ggg-----------------------------tgaactgggg-----gag
F6PH48_BCL2L2-01       g-----------------------------ccccaactgggg-----ccg
F6ZPD4_BCL2L10-01      gcgatcttcggagaccgccacgt-------ccccagctgggg-----ccg
F7AVA6_MCL1-01         gagcctctcgggaagcggccggctgtcctgcccttgctggagtttgtccg
                       *                                   **** *       *

F7CP56_BCL2A1-01       aattatgaccatatttgcatttgaaggtattc------------------
F6WQI0_BCL2L1-01       cattgtggcctttttctccttcggtgggg---------------------
F6WQI0_BCL2L1-02       cattgtggcctttttctccttcggtgggg---------------------
F7CDX6_BCL2-02         gattgtggccttctttgagttcggtggggtca------------------
F7CDX6_BCL2-01         gattgtggccttctttgagttcggtggggtca------------------
F6PH48_BCL2L2-01       ccttgtggccttc-tttgtctttg--gagccg------------------
F6ZPD4_BCL2L10-01      cgtggcggcgctc-gtgaccctggcggggacg------------------
F7AVA6_MCL1-01         ggaggc--cagca-gtggcccctgcacggacggctcgctcccctcgacgc
                               *                                         

F7CP56_BCL2A1-01       ------------------------------tcatcaagaaacttctacca
F6WQI0_BCL2L1-01       ------------------------------------------cactgtgc
F6WQI0_BCL2L1-02       ------------------------------------------cactgtgc
F7CDX6_BCL2-02         ---------------------------------------------tgtgt
F7CDX6_BCL2-01         ---------------------------------------------tgtgt
F6PH48_BCL2L2-01       ------------------------------------------cgctgtgt
F6ZPD4_BCL2L10-01      -----------------------------------------ctgctg---
F7AVA6_MCL1-01         cgcccccagcagaggaggaggaggacgagttgtaccggcaatcgctg---
                                                                    *    

F7CP56_BCL2A1-01       gagcgaattgcccc-----------------------------------a
F6WQI0_BCL2L1-01       gtggaaagcgta------------------------------gacaagga
F6WQI0_BCL2L1-02       gtggaaagcgta------------------------------gacaagga
F7CDX6_BCL2-02         gtggagagcgtc------------------------------aaccggga
F7CDX6_BCL2-01         gtggagagcgtc------------------------------aaccggga
F6PH48_BCL2L2-01       gctgagagtgtc------------------------------aacaagga
F6ZPD4_BCL2L10-01      ---gagagagccccgcg--------gggaac---ctaccgaaagc-----
F7AVA6_MCL1-01         ---gagattatctctcgttaccttcgggaacaggctaccggcaccaagga
                             *                                           

F7CP56_BCL2A1-01       gatgtggatacttacaa-----ggagatttcttactttgttgctgagttc
F6WQI0_BCL2L1-01       gatgcaggtattgg--------tgagtcggatcgcaacctggatggccac
F6WQI0_BCL2L1-02       gatgcaggtattgg--------tgagtcggatcgcaacctggatggccac
F7CDX6_BCL2-02         gatgtcgcccctgg--------tggacaacatcgccctgtggatgactga
F7CDX6_BCL2-01         gatgtcgcccctgg--------tggacaacatcgccctgtggatgactga
F6PH48_BCL2L2-01       gatggagccacttg--------tgggacaagtgcaggagtggatggtggc
F6ZPD4_BCL2L10-01      --cgaagc--------------ggggctacaagctggagctgagggag--
F7AVA6_MCL1-01         cacgaagccaatgggcgggtctggggccgccagccgga----aggcgt--
                          *  *                *                    *     

F7CP56_BCL2A1-01       ataacgaaaaacacagga----------gaatggataaggcaaaatggag
F6WQI0_BCL2L1-01       ttacctgaatgaccacctagagcct------tggatccaagagaacggcg
F6WQI0_BCL2L1-02       ttacctgaatgaccacctagagcct------tggatccaagagaacggcg
F7CDX6_BCL2-02         atacctgaa---ccggcacctgcac---acctggatccaggataacggag
F7CDX6_BCL2-01         atacctgaa---ccggcacctgcac---acctggatccaggataacggag
F6PH48_BCL2L2-01       ctacctggagactcggc---tggcc---gactggatccacagcagtggag
F6ZPD4_BCL2L10-01      -----tggaaggccggcg--tggaccgggactggctgcg----------c
F7AVA6_MCL1-01         -----tagagaccctgcggcgggtcggggacggagtgcagcgcaat---c
                               *    *                  *  *              

F7CP56_BCL2A1-01       gctgggaaaa----------------------------------------
F6WQI0_BCL2L1-01       gctgg---gacacctttgtgga----------------------------
F6WQI0_BCL2L1-02       gctggaaagaaactgctttggg----------------------------
F7CDX6_BCL2-02         gctgg--caactttgccaagcaccaaca----------------------
F7CDX6_BCL2-01         gctgggacgcctttgt---ggaactgta----------------------
F6PH48_BCL2L2-01       gctgggcggagttca-----------------------------------
F6ZPD4_BCL2L10-01      gcctggtggacttcctgtgcgca---------------------------
F7AVA6_MCL1-01         acgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaa
                        *  *                                             

F7CP56_BCL2A1-01       ----------------tggctttgtaaagaa-------------------
F6WQI0_BCL2L1-01       ----------------actctacgggaacaac------------------
F6WQI0_BCL2L1-02       ----------------gaccttctgctacttc------------------
F7CDX6_BCL2-02         ----------------ggctctcaggaaatgt------------------
F7CDX6_BCL2-01         ----------------cggccccagca-----------------------
F6PH48_BCL2L2-01       ----------------cagctctatacgggg-------------------
F6ZPD4_BCL2L10-01      ----------------tggctcaaggggcggc------------------
F7AVA6_MCL1-01         gacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacgg
                                                                         

F7CP56_BCL2A1-01       --------gtttgaacccaaatctggc-----------tggctgactttt
F6WQI0_BCL2L1-01       --------gcggcagcc-----gaaagcc---------ggaagggcca--
F6WQI0_BCL2L1-02       --------gtttcatccctgatgagactc---------tca--ggccaag
F7CDX6_BCL2-02         --------tcagcggtgggtggaccattc-----attctggctctccatt
F7CDX6_BCL2-01         ----------tgcggccgctgtttgattt-----ctcctggctgtctct-
F6PH48_BCL2L2-01       --------acggggccctggaggaggcgc--------------ggcgtct
F6ZPD4_BCL2L10-01      --------accgcgcctggctggaggctc-----actatggatggctttt
F7AVA6_MCL1-01         agtgacaaactggggcaggattgtgactcttatttcttttggt-gccttt
                                                                    *    

F7CP56_BCL2A1-01       ctgg----------------------------aagtt-------------
F6WQI0_BCL2L1-01       --gg-----------------------------agc--------------
F6WQI0_BCL2L1-02       gcgg-----------------------------agcctt-----------
F7CDX6_BCL2-02         gcag-----aatctttgtgtgtcaagggcaggaaattgg-----------
F7CDX6_BCL2-01         -------------------------------gaaggcgc-----------
F6PH48_BCL2L2-01       gcgg-----------------------gaggggaactgg-----------
F6ZPD4_BCL2L10-01      gtgacttctcactc------------------acactgc-----------
F7AVA6_MCL1-01         gtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccatt
                                                                         

F7CP56_BCL2A1-01       --------actggaaagatg--------tgtgaaatacttttcctga---
F6WQI0_BCL2L1-01       --------gcttcaa-------------ccgctggttcctgacg------
F6WQI0_BCL2L1-02       -acagctagctccaa-------------gctacagtgctttttg------
F7CDX6_BCL2-02         --------ttttcagag-----------aagaaaaatatga-cttggtgt
F7CDX6_BCL2-01         --------tgctcag---------------------tctggccctggtg-
F6PH48_BCL2L2-01       --------gcctcagtg-----------aggacagtgctgacaggggccg
F6ZPD4_BCL2L10-01      ------cagcttctcag-----------aggatactgctggtccggtttc
F7AVA6_MCL1-01         agcagaaagcatcacagatgtcctcgtaaggacaaaacgagactggctag
                                                                         

F7CP56_BCL2A1-01       --------------------------------------------------
F6WQI0_BCL2L1-01       --------------------------------------------------
F6WQI0_BCL2L1-02       --------------------------------------------------
F7CDX6_BCL2-02         ttaacttcagacaaggatgtaatcgacaggacacccatccgcatgtatca
F7CDX6_BCL2-01         ----------------------------gga---------gcttgcatca
F6PH48_BCL2L2-01       t-------------------------------------------------
F6ZPD4_BCL2L10-01      t----------------------tctgtcat---------gcttttc---
F7AVA6_MCL1-01         tcaaacaaagaggctgggatgggtttgtgga---------gttcttccat
                                                                         

F7CP56_BCL2A1-01       ------------------agcaatactactga------------------
F6WQI0_BCL2L1-01       ------------------ggcatgactgtgg--------ctggt-----g
F6WQI0_BCL2L1-02       ------------------ggca-gactccagagct-cccctcggaactag
F7CDX6_BCL2-02         gggaaggaagagtagagaggcagaaatacaaagccagtgcagacctccgt
F7CDX6_BCL2-01         ------------------------------------------ccctgggt
F6PH48_BCL2L2-01       ------------------ggcattgg--------gggccctggtaactgt
F6ZPD4_BCL2L10-01      ------------------agcatcagtcttaatctacctctg--------
F7AVA6_MCL1-01         gtagaggacctagaaggtggcatcag---aaatgtgctgctggcttttgc
                                                                         

F7CP56_BCL2A1-01       --------------------------------------------------
F6WQI0_BCL2L1-01       tggttctgctgggctcactcttcagt--------c-------------gg
F6WQI0_BCL2L1-02       aggtttttct---ctcgctcttcaggaaatgccat-------------tg
F7CDX6_BCL2-02         gcatgctgctgcacctgctggaaatccaggttccagttctgtttctcagt
F7CDX6_BCL2-01         gcct-------------------atctgggccaca---------------
F6PH48_BCL2L2-01       aggggc--------------cttttttg------c-----------tagc
F6ZPD4_BCL2L10-01      ---------------------------gacaaaat-----------tatc
F7AVA6_MCL1-01         aggtgttgctggagtaggcgctggtttggcatatc-----------taat
                                                                         

F7CP56_BCL2A1-01       -------
F6WQI0_BCL2L1-01       aagtga-
F6WQI0_BCL2L1-02       caatga-
F7CDX6_BCL2-02         gagtaa-
F7CDX6_BCL2-01         -agtga-
F6PH48_BCL2L2-01       aagtga-
F6ZPD4_BCL2L10-01      atga---
F7AVA6_MCL1-01         aagatag
                              

© 1998-2019