Dataset for CDS BCL-2-like of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F7CP56_BCL2A1-01       atg----------------------------accga--------------
F6WQI0_BCL2L1-01       atgtc------------------tcagagcaaccgggagctggtggttga
F7CDX6_BCL2-01         atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaa
F6PH48_BCL2L2-01       atggcgacc-----------------------ccag--------------
F6ZPD4_BCL2L10-01      --------------------------------ccgg--------------
F7AVA6_MCL1-01         atgtttggcctgaaaagaa----acgcagtaatcgg--------------

F7CP56_BCL2A1-01       ---------ctgtgagttt-----ggatatattcacatgctggcccagga
F6WQI0_BCL2L1-01       ctttctctcctacaagctttcccagaaaggatacaa--------ctggag
F7CDX6_BCL2-01         gtacatccactataagctgtcgcagaggggctacgagtgggatgccggag
F6PH48_BCL2L2-01       ---------cctcagcccc-------agacacacgggct-----------
F6ZPD4_BCL2L10-01      ---------ccacgccc--------gaggtggccgtgct-----------
F7AVA6_MCL1-01         ---------actcaacctctactgtgggggggccgggttgggggccggcg

F7CP56_BCL2A1-01       ctacctgaagtacgt-----------------------------------
F6WQI0_BCL2L1-01       tcagtttagtgacgtggaagagaacagaactgaggccccagaagggactg
F7CDX6_BCL2-01         acgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcc
F6PH48_BCL2L2-01       ----------ctagtggcag--------------actttgtaggctataa
F6ZPD4_BCL2L10-01      ------gcgctgcgtggccg------------------------------
F7AVA6_MCL1-01         gcggcggcgcctcgtcgccg--------------ggagggcggcttttgg

F7CP56_BCL2A1-01       --------------------------------------------------
F6WQI0_BCL2L1-01       aatcagagatggagacccc----------cagtgccatcaatggcaaccc
F7CDX6_BCL2-01         tcccagcccgggcgcaccc------------ccgcgcccgccaggacctc
F6PH48_BCL2L2-01       gctgaggcagaagggttat-------------------------------
F6ZPD4_BCL2L10-01      --------------------------------------------------
F7AVA6_MCL1-01         ctgcggggaaggaggccacggcccggcgagagggagggggaggggaggcc

F7CP56_BCL2A1-01       ----------cctgcagataccacaacctgg-------------------
F6WQI0_BCL2L1-01       atcctggcacctggcggacagccccacggggaatggagccactggccaca
F7CDX6_BCL2-01         cccgctgctacccccggccgcccccgccggc-------------------
F6PH48_BCL2L2-01       ------gtttgtggagctggccccggggagg-------------------
F6ZPD4_BCL2L10-01      ---------------------cccagataca-------------------
F7AVA6_MCL1-01         ggcgcggtgattggcggaagcgccggcggga-------------------

F7CP56_BCL2A1-01       ----------------------atctggtccaagcaaaaca---------
F6WQI0_BCL2L1-01       gcagcagcttggatgcccgggaagtgatccccatggcagca---------
F7CDX6_BCL2-01         --------------gccgcgggacctgccctcagccctgtgccacctgtg
F6PH48_BCL2L2-01       --------------gcccagccgctgacccactgcaccaag---------
F6ZPD4_BCL2L10-01      --------------gccccgcaacca------------------------
F7AVA6_MCL1-01         --------------gcccccagaccaccctcgcgccggact---------

F7CP56_BCL2A1-01       ----------tccagagtgttacaagacattgctttctc-----------
F6WQI0_BCL2L1-01       gtgaagcaagcgctgagggaggcaggcgatgagttt--------------
F7CDX6_BCL2-01         gtccacctgaccctgcgccaggccggcgatgacttctcc-----------
F6PH48_BCL2L2-01       ----------ccatgcgggcagctggagatgagttt--------------
F6ZPD4_BCL2L10-01      ---------------------gc-----gtgttctttcc-----------
F7AVA6_MCL1-01         ----------ccctgagggtcgc-----gcggccctcccccattggcgcc

F7CP56_BCL2A1-01       ----------agttcaaaatgaagtagagaagaatttgaaaccatgcttg
F6WQI0_BCL2L1-01       --gaactgaggtaccggcgggcattcagcga------------cctgaca
F7CDX6_BCL2-01         -----cgtcgctaccgccgcgactttgccgaga------------tgtcc
F6PH48_BCL2L2-01       --gagacccgcttccggcgcaccttctctga------------tctggcg
F6ZPD4_BCL2L10-01      -----------cgctaccgcggcttccgcggggac---------------
F7AVA6_MCL1-01         gagggccccgacgtcaccgcgccctcctccaggctgctgttcttcgcgcc

F7CP56_BCL2A1-01       gacaattttcatgttgtgtccatagatgctgccagaacaatattcaatca
F6WQI0_BCL2L1-01       tcccagctcca---catcaccccagggacagcatatcagagctttgagca
F7CDX6_BCL2-01         agccagctgca---cctgacgcctttcaccgcaaggggacgctttgccac
F6PH48_BCL2L2-01       gctcagctgca---tgtgaccccgggctcagcccagcaacgcttcaccca
F6ZPD4_BCL2L10-01      ---------ca---cgt---cg--ggctggcggcacggatggcgcaggcg
F7AVA6_MCL1-01         cacccgctgcg---cgt---cgccgcctgaggggatggaagccccggccg
                                *      *                                 

F7CP56_BCL2A1-01       agtgatggaaaagcaatttgaagatggcatc-------------------
F6WQI0_BCL2L1-01       ggtagtgaatgaactcttccgggatggggtg-------------------
F7CDX6_BCL2-01         ggtagtggaggagctcttcagggatggggtg-------------------
F6PH48_BCL2L2-01       ggtctctgacgaactcttccaaggtggcccc-------------------
F6ZPD4_BCL2L10-01      atcttcggaga-------ccgccacgtcccc-------------------
F7AVA6_MCL1-01         -----ccgacg-------ccatcatgtcgcccgaggaggagctggacggg
                               *                *                        

F7CP56_BCL2A1-01       -attaactggggaagaatta--------tgaccatatttgcat-------
F6WQI0_BCL2L1-01       ----aactggggtcgcattg--------tggcctttttctcct-------
F7CDX6_BCL2-01         ----aactgggggaggattg--------tggccttctttgagt-------
F6PH48_BCL2L2-01       ----aactggggccgccttg--------tggccttctttg----------
F6ZPD4_BCL2L10-01      ----agctggggccgcgtgg--------cggcgctc--------------
F7AVA6_MCL1-01         tacgagccggagcctctcgggaagcggccggctgtcctgcccttgctgga
                           * * ** *                 * *  *               

F7CP56_BCL2A1-01       --------------------------------------------------
F6WQI0_BCL2L1-01       --------------------------------------------------
F7CDX6_BCL2-01         --------------------------------------------------
F6PH48_BCL2L2-01       --------------------------------------------------
F6ZPD4_BCL2L10-01      --------------------gtgaccctggcggggacg------------
F7AVA6_MCL1-01         gtttgtccgggaggccagcagtggcccctgcacggacggctcgctcccct

F7CP56_BCL2A1-01       --------------------------------------------------
F6WQI0_BCL2L1-01       -----------------------------------------------tcg
F7CDX6_BCL2-01         -----------------------------------------------tcg
F6PH48_BCL2L2-01       -----------------------------------------------tct
F6ZPD4_BCL2L10-01      -----------------------------------------------ctg
F7AVA6_MCL1-01         cgacgccgcccccagcagaggaggaggaggacgagttgtaccggcaatcg

F7CP56_BCL2A1-01       ttgaag--------gtattctcatcaagaaa-------cttctaccagag
F6WQI0_BCL2L1-01       gtgggg---------cactgtgcgtggaaag-------cgtagacaagg-
F7CDX6_BCL2-01         gtgggg------tcatg---tgtgtggagag-------cgtcaaccggg-
F6PH48_BCL2L2-01       ttggag------ccgcgctgtgtgctgagag-------tgtcaacaagg-
F6ZPD4_BCL2L10-01      ctggagagagccccgcg--------gggaac---ctaccgaaagc-----
F7AVA6_MCL1-01         ctggagattatctctcgttaccttcgggaacaggctaccggcaccaagg-
                        **  *                       *              *     

F7CP56_BCL2A1-01       cgaattgccccagatgtggatacttacaa-----ggagatttcttacttt
F6WQI0_BCL2L1-01       -----------agatgcaggtattgg--------tgagtcggatcgcaac
F7CDX6_BCL2-01         -----------agatgtcgcccctgg--------tggacaacatcgccct
F6PH48_BCL2L2-01       -----------agatggagccacttg--------tgggacaagtgcagga
F6ZPD4_BCL2L10-01      --------------cgaagc--------------ggggctacaagctgga
F7AVA6_MCL1-01         -----------acacgaagccaatgggcgggtctggggccgccagccgga
                                      *  *                *              

F7CP56_BCL2A1-01       gttgctgagttcataacgaaaaacac----aggagaatggataaggcaaa
F6WQI0_BCL2L1-01       ctggatggccacttacctgaatgaccacctagagccttggatccaagaga
F7CDX6_BCL2-01         gtggatgactgaatacctgaaccggcacctgcacacctggatccaggata
F6PH48_BCL2L2-01       gtggatggtggcctacctggagactcggctggccgactggatccacagca
F6ZPD4_BCL2L10-01      g---ctg-----------agggagtggaa-ggccggcgtggaccgggacg
F7AVA6_MCL1-01         aggcgtt-----------agagaccctgc-ggcgggtcggggacggagtg
                            *                                 *          

F7CP56_BCL2A1-01       atgga----ggctgggaaaa------------------------------
F6WQI0_BCL2L1-01       acggc----ggctgggacacctttg-------------------------
F7CDX6_BCL2-01         acgga----ggctgggacgcctttg-------------------------
F6PH48_BCL2L2-01       gtgga----ggctgggcggagttca-------------------------
F6ZPD4_BCL2L10-01      ctgcg----cgcctggtggacttcctgtgcgca-----------------
F7AVA6_MCL1-01         cagcgcaatcacgagacggccttccaaggcatgcttcggaaactggacat
                         *        *  *                                   

F7CP56_BCL2A1-01       --------------------------tggctttgtaaagaag--------
F6WQI0_BCL2L1-01       --------------------------tggaactctacgggaac-------
F7CDX6_BCL2-01         --------------------------tggaactgt---------------
F6PH48_BCL2L2-01       --------------------------cagctctatacgggg---------
F6ZPD4_BCL2L10-01      --------------------------tggctcaaggggcggc--------
F7AVA6_MCL1-01         caaaaatgaagacgatgtcaaatctttgtctcgagtgatggcccacgttt

F7CP56_BCL2A1-01       ------------------tttgaacccaaatctggctgg-----------
F6WQI0_BCL2L1-01       ------------------aacgcggcagccgaaagccgg--aagggccag
F7CDX6_BCL2-01         ------------------acggccccagcatgcggccgc-----------
F6PH48_BCL2L2-01       ------------------acggggccctggaggaggcgc-----------
F6ZPD4_BCL2L10-01      ------------------accgcgcctggctggaggctcactatggctgg
F7AVA6_MCL1-01         tcagtgacggagtgacaaactggggcaggattgtgactc-ttatttcttt
                                            *   *        *               

F7CP56_BCL2A1-01       ---------------------------------------------ctga-
F6WQI0_BCL2L1-01       gagcgcttcaaccg-------------------------------ctgg-
F7CDX6_BCL2-01         -------tgtttgatttctc-------------------------ctgg-
F6PH48_BCL2L2-01       ---ggcgtctgcgg-----------------------gaggggaactgg-
F6ZPD4_BCL2L10-01      gtgggcttttgtgacttctcactc------------------acactgc-
F7AVA6_MCL1-01         tggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca

F7CP56_BCL2A1-01       -------------------cttttctg-------------gaagttactg
F6WQI0_BCL2L1-01       ---------------------ttcctgacgggc-----atgactgtggct
F7CDX6_BCL2-01         ------------------ctgtctctg-----------aaggcgctgctc
F6PH48_BCL2L2-01       ------------------gcctcagtg-----------aggacagtgctg
F6ZPD4_BCL2L10-01      ----------------cagcttctcag-----------aggatactgctg
F7AVA6_MCL1-01         tcgaaccattagcagaaagcatcacagatgtcctcgtaaggacaaaacga
                                            *    *             *         

F7CP56_BCL2A1-01       gaaagatgtgt---------------------------------------
F6WQI0_BCL2L1-01       ggtgtggttct---------------------------------------
F7CDX6_BCL2-01         agtctggccct---------------------------------------
F6PH48_BCL2L2-01       acaggggccgt---------------------------------------
F6ZPD4_BCL2L10-01      gtccggtttct----------------------tctgtcatgcttttc--
F7AVA6_MCL1-01         gactggctagtcaaacaaagaggctgggatgggtttgtggagttcttcca

F7CP56_BCL2A1-01       --------------------------gaaatacttttcctgaagcaatac
F6WQI0_BCL2L1-01       ----------------------gctgggctcactcttcagtcgg------
F7CDX6_BCL2-01         ---------ggtgggagcttgcatca-----------ccctgggtgccta
F6PH48_BCL2L2-01       -------------------ggcattgg--------gggccctggtaactg
F6ZPD4_BCL2L10-01      -------------------agcatcagtcttaatctacctctgg------
F7AVA6_MCL1-01         tgtagaggacctagaaggtggcatcag---aaatgtgctgctggcttttg

F7CP56_BCL2A1-01       t-----------------------------------------attga
F6WQI0_BCL2L1-01       -----------------------------------------aagtga
F7CDX6_BCL2-01         tctgggccac-------------------------------aagtga
F6PH48_BCL2L2-01       taggggccttttttgctagc---------------------aagtga
F6ZPD4_BCL2L10-01      --------------------------------------acaaaatta
F7AVA6_MCL1-01         caggtgttgctggagtaggcgctggtttggcatatctaataagatag

© 1998-2019