Dataset for CDS BCL2L1 of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6WQI0_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
F6WQI0_BCL2L1-02      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                      **************************************************

F6WQI0_BCL2L1-01      ttcccagaaaggatacaactggagtcagtttagtgacgtggaagagaaca
F6WQI0_BCL2L1-02      ttcccagaaaggatacaactggagtcagtttagtgacgtggaagagaaca
                      **************************************************

F6WQI0_BCL2L1-01      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
F6WQI0_BCL2L1-02      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
                      **************************************************

F6WQI0_BCL2L1-01      atcaatggcaacccatcctggcacctggcggacagccccacggggaatgg
F6WQI0_BCL2L1-02      atcaatggcaacccatcctggcacctggcggacagccccacggggaatgg
                      **************************************************

F6WQI0_BCL2L1-01      agccactggccacagcagcagcttggatgcccgggaagtgatccccatgg
F6WQI0_BCL2L1-02      agccactggccacagcagcagcttggatgcccgggaagtgatccccatgg
                      **************************************************

F6WQI0_BCL2L1-01      cagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgagg
F6WQI0_BCL2L1-02      cagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgagg
                      **************************************************

F6WQI0_BCL2L1-01      taccggcgggcattcagcgacctgacatcccagctccacatcaccccagg
F6WQI0_BCL2L1-02      taccggcgggcattcagcgacctgacatcccagctccacatcaccccagg
                      **************************************************

F6WQI0_BCL2L1-01      gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
F6WQI0_BCL2L1-02      gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
                      **************************************************

F6WQI0_BCL2L1-01      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
F6WQI0_BCL2L1-02      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
                      **************************************************

F6WQI0_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
F6WQI0_BCL2L1-02      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                      **************************************************

F6WQI0_BCL2L1-01      aacctggatggccacttacctgaatgaccacctagagccttggatccaag
F6WQI0_BCL2L1-02      aacctggatggccacttacctgaatgaccacctagagccttggatccaag
                      **************************************************

F6WQI0_BCL2L1-01      agaacggcggctgg---gacacctttgtggaactctacgggaacaacgcg
F6WQI0_BCL2L1-02      agaacggcggctggaaagaaactgctttggggaccttctgctacttcgtt
                      **************   ** **   * ***    ** * *  **  **  

F6WQI0_BCL2L1-01      gcagcc-----gaaagccggaagggcca----ggagc----------gct
F6WQI0_BCL2L1-02      tcatccctgatgagactctca--ggccaaggcggagccttacagctagct
                       ** **     ** *  *  *  *****    *****          ***

F6WQI0_BCL2L1-01      tcaaccgctggttcctgacgggcatgactgtgg-------ctggt-----
F6WQI0_BCL2L1-02      ccaagctacagtgctttttgggca-gactccagagctcccctcggaacta
                       *** *    ** * *   ***** ****   *       ** *      

F6WQI0_BCL2L1-01      gtggttctgctgggctcactcttcagt--------cggaagtga
F6WQI0_BCL2L1-02      gaggtttttct---ctcgctcttcaggaaatgccattgcaatga
                      * **** * **   *** ********           * * ***

© 1998-2019